Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,201-7,2207,221-7,2407,241-7,260 ... 19,381-19,391 next last
To: JonPreston

With a name like Klit_schko I’d expect nothing less


7,221 posted on 10/14/2024 2:39:49 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7219 | View Replies]

To: blitz128

He’s always desperate. He gets paid buy the number of responses he stirs up. So 10 rubles here and another 10 over there & pretty soon he’ll have 50 cents.


7,222 posted on 10/14/2024 2:42:02 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7220 | View Replies]

To: PIF

It’s expensive to shop at wildberry and dangerous now😎


7,223 posted on 10/14/2024 2:44:31 PM PDT by blitz128
[ Post Reply | Private Reply | To 7222 | View Replies]

To: PIF; All

“Israeli Prime Minister Benjamin Netanyahu has agreed to limit his country’s retaliation against Iran over the missile attack on Oct. 1 to military targets, according to a report in the Washington Post.

Netanyahu has told the Biden administration that he would strike those types of targets rather than Iran’s oil infrastructure or nuclear installations, the Post reported, citing two officials familiar with the matter whom it didn’t identify.”


7,224 posted on 10/14/2024 3:40:40 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7223 | View Replies]

Russian Offensive Campaign Assessment, October 14, 2024

Russian Defense Minister Andrei Belousov arrived in the People's Republic of China (PRC) for an official visit on October 14, highlighting continued Russia-PRC defense cooperation against the backdrop of bilateral naval exercises in the Pacific Ocean. Belousov met with PRC Defense Minister Dong Jun in Beijing on August 14 and discussed the role of bilateral cooperation in enhancing each state's respective defensive capabilities and maintaining global security and regional stability.[1] Dong emphasized that Russia and the PRC share a common desire to develop military cooperation and open new avenues for unspecified joint defense cooperation.[2] The Russian Ministry of Defense (MoD) notably published footage on October 14 of ongoing joint Russia-PRC People's Liberation Army (PLA) anti-submarine naval exercises in the northwestern Pacific Ocean and claimed that a detachment of Russian and PLA naval vessels are conducting a joint patrol of the Asia–Pacific region.[3] Such joint naval exercises are manifestations of intensified Russia-PRC defense cooperation, as each party can learn valuable lessons from one another during combined exercises, improving interoperability and potentially shaping military doctrine in the future. Russian forces have experience repelling Ukrainian autonomous naval drone strikes against Russian naval and port infrastructure, and the PLA may hope to absorb some of these lessons in planning for the PRC's potential future actions against Taiwan. Taiwan's MoD warned that the PRC launched “massive military drills” encircling Taiwan with warships on October 14, which overlapped with Belousov’s visit.[4]

Russian forces struck civilian vessels docked at Ukrainian ports for the fourth time since October 5, part of an apparent Russian strike campaign targeting port areas to undermine Ukraine's grain corridor, spoil international support for Ukraine, and push Ukraine into premature negotiations. Odesa Oblast officials reported that Russian forces struck the port of Odesa with a ballistic missile during the day on October 14, hitting the civilian vessels NS Moon flying the Belize flag and the Optima dry cargo vessel flying the Palau flag, as well as port infrastructure and a grain warehouse.[5] The officials stated that Russian strikes on October 7 already damaged the Optima. Ukrainian sources reported that Russian forces most recently struck civilian vessels docked at the port of Odesa overnight on October 5 to 6 and on October 7 and 9.[6] Russian ultranationalist milbloggers responded to the October 9 strike with rhetoric supporting existing Kremlin narratives aimed at undermining confidence in the grain corridor as well as attempting to justify the strike.[7] Milbloggers explicitly called for further Russian strikes against Ukrainian grain infrastructure, civilian vessels at Ukrainian ports, and other targets that would further degrade Ukraine's economic potential. ISW recently assessed that Russian strikes against civilian vessels and other grain corridor infrastructure are almost certainly intended to undermine Western confidence in Ukraine's ability to enforce and defend the corridor, influence ongoing Western discussions about long-term support for Ukraine, and impede Ukraine's ability to survive economically during the war.[8]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-14-2024

7,225 posted on 10/14/2024 11:39:01 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7203 | View Replies]


7,226 posted on 10/14/2024 11:42:33 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7204 | View Replies]

To: SpeedyInTexas

Netanyahu has agreed to limit his country’s retaliation against Iran ... to military targets


Now Iran will be able to concentrate all their newly acquired S-300 and S-400 systems.


7,227 posted on 10/15/2024 5:49:22 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7224 | View Replies]

To: marcusmaximus

🇰🇵 Zelensky Says North Korean Troops are on the Way to Ukraine

"North Korea is increasing cooperation with Russia. This is no longer just about the transfer of weapons – the DPRK is transferring troops to Russia," the possibly intoxicated President of Ukraine babbled. pic.twitter.com/Omf85ZzgVK— James Porrazzo (@JamesPorrazzo) October 13, 2024


7,228 posted on 10/15/2024 5:53:29 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7190 | View Replies]

To: PIF
Netanyahu has agreed to limit his country’s retaliation against Iran ... to military targets

My guess is that the biden admin does not consider Iran's petroleum industry to be a military target.

In return, biden agreed to deploy a THAAD battery to Israel.

ATACMs has proven that S-300 and S-400 systems are worthless against ballistic missiles.

7,229 posted on 10/15/2024 6:47:08 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7227 | View Replies]

To: PIF
🇰🇵🏃 18 servicemen from North Korea have already escaped from positions on the border of the Bryansk and Kursk regions, - UP

🇺🇦 The event took place 7 kilometers from the state border with Ukraine.

https://x.com/Maks_NAFO_FELLA/status/1846167607109460261

Perhaps they will be given asylum in South Korea.


7,230 posted on 10/15/2024 6:54:03 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7229 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Finally! Successful F-16 Mission. Russian Jets Downed ]


Today [ Oct 15 ], there are a lot of updates from the Russian Federation.

Ukrainian forces have finally deployed F-16 fighter jets, successfully taking down Russian aircraft as enemy forces continue to use glide bombs against frontline positions and infrastructure. In addition to these aerial victories, Ukraine’s military has also destroyed several key depots holding bombs used by Russian jets to target Ukrainian strongholds and civilian areas.

A prominent military analyst and former Russian aviator has reported that a Russian SU-34 fighter bomber was shot down while conducting a glide-bombing mission roughly 50 kilometers from the front lines, resulting in the deaths of the crew. The aircraft was reportedly downed by an F-16 operating over Ukrainian-held territory.

The analyst warned that more such incidents are likely, as Ukraine has now deployed F-16s with superior air-to-air combat capabilities provided by Western allies to target Russian aircraft. The incident occurred in the Donetsk region, an area of intense fighting. Russian forces have been heavily relying on glide bombs to gradually destroy Ukrainian defenses, making the interception of these aircraft a crucial priority for Ukraine’s military strategy.

Before that, Russian sources stated that there was another accident with one of their SU-25 combat airplanes being shot down near the frontline again. Military analysts commented that such losses will undoubtedly contribute to fewer bombardments on Ukrainian positions with FABs which will consequently lead to Russian infantry losses increasing due to the increased Ukrainian activity.

To bolster the effectiveness of its combat aviation and intensify pressure on Russian operations, Ukrainian forces have continued targeting deep inside enemy territory using drones. The latest strike hit a Russian ammunition storage facility in the Bryansk region, which housed glide bombs, missiles, artillery systems, and weaponry supplied by North Korea and Iran.

Geolocated footage of the attack reveals fires and secondary explosions, contradicting Russian claims that over 20 Ukrainian drones were intercepted, and the strike was unsuccessful. This ammunition depot is a critical asset for Russia, as it is one of only 20 facilities in the country capable of modernizing various types of military equipment.

The next Ukrainian strike targeted the Krasnodar region, focusing on a warehouse reportedly storing 400 Iranian Shahed drones. Geolocated footage confirmed a direct hit, with secondary explosions observed at the site. Unlike previous attacks, this operation did not involve drones; instead, Ukrainian forces used a Neptune cruise missile, with the Ukrainian Navy confirming its involvement in the mission.

The use of such a valuable weapon underscores the significance of the target, and demonstrates the extensive intelligence gathered by Ukraine on Russian logistics, and highlights their capability to disrupt Russia’s supply chain and degrade its operational capacity.

The Ukrainian General Staff reported on the second target in Krasnodar - the ammunition warehouse at the Khanskaya Air Base, which houses SU-34 and SU-27 fighter aircraft. According to sources within Ukrainian special services, there were 57 Russian training and combat aircraft of various types at the time of the strike. The Defense Intelligence of Ukraine released a rare video showing the launch of the Bober drones used for the attack with this variant being in black to make detection and countermeasures even harder.

The airfield is a priority target not only because it is used to refuel planes during air strikes against frontline Ukrainian units and settlements, but also due to the fact the Krasnodar Aviation School of Pilots is located there.

While the damage caused to it is still to be determined, military analysts commented that even one single strike is unlikely significant enough to impact Russia’s war effort, this repeated series of strikes against ammunition depots and airfields may force a decision point on the military command to reorganize and disperse support and logistics systems within Russia’s rear areas to mitigate the impact.

The Ukrainian military also targeted a fuel and lubricant storage facility in the Luhansk region which contained crude oil and petroleum products used by the Russian Armed Forces.

This depot has been struck before, reflecting its strategic significance in supporting Russian military operations, particularly amid ongoing offensives in the east. Its repeated targeting underscores Ukraine’s efforts to disrupt Russian logistics and weaken its capacity to sustain the war effort.

Overall, Ukraine has deployed every available tool in its arsenal to counter Russian air strikes involving glide bombs and drones.

The ongoing advancement of Ukraine’s long range strike capabilities offers the potential to better exploit Russian vulnerabilities and diminish its offensive strength. These strikes on facilities within Russia have a significant impact on military operations across the entire war theater.

However, for Ukraine to fully capitalize on this efforts it needs more resources and capabilities, including authorization to conduct a large scale strike campaign. This will require the timely lifting of restrictions on the use of Western supplied systems which is anticipated soon.


7,231 posted on 10/15/2024 6:54:48 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7229 | View Replies]

To: SpeedyInTexas
In Toretsk, not a single building remains intact.

Soldiers of the 4th Battalion, 101st Brigade of the General Staff are searching through the ruins for Russian assault forces and target them with FPV drones.

https://x.com/NOELreports/status/1846125185495093437

Toretsk on Google Maps


7,232 posted on 10/15/2024 7:10:12 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7230 | View Replies]

A Russian Su-25 was downed, likely by friendly fire near Bakhmut on 02.10.2024. The aircraft belonged to the 960th Assault Aviation Regiment. Pilot Lt. Colonel Igor Gaivoronsky reportedly was killed.

https://x.com/NOELreports/status/1846185395265876422


7,233 posted on 10/15/2024 7:14:28 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7232 | View Replies]

To: PIF
❤️🇺🇦 For the first time in the last 48 (!) days, the night passed without "Shaheds" in Ukraine.

https://x.com/Maks_NAFO_FELLA/status/1845710271001624924


7,234 posted on 10/15/2024 7:29:18 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7233 | View Replies]

To: PIF; All

Very unfortunate

“The commander of Wagner’s / Africa Corps’ 9th Assault Detachment, Mikhail Prikhodko, call sign “Michael”, was reportedly killed in Mali on October 12th.”

https://x.com/RALee85/status/1845942129211654451


7,235 posted on 10/15/2024 7:48:27 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7233 | View Replies]

To: PIF; All

Can’t make this stuff up.

“The Russian State Duma proposed reducing the mortgage rate by 1% for the birth of each child. This measure is intended to “support families and encourage the country’s birth rate”.

Meanwhile, mortgage rates in Russia have reached record highs: the average rate for new housing exceeded 23%, and for secondary housing, it was 22.3%.”

https://x.com/wartranslated/status/1846101183682777378


7,236 posted on 10/15/2024 7:57:22 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7235 | View Replies]

To: PIF; All

Slovakia and Austria have had 2.5 years to end dependence on RuZZia. Time for them to feel the pain.

“EU gas storage is full and flows through the Ukrainian route now account for less than 5% of the continent’s supplies. Yet for countries including Slovakia and Austria finding new imports could mean higher prices, a fact that politicians don’t like.”


7,237 posted on 10/15/2024 8:05:34 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7236 | View Replies]

To: PIF; All

“The Biden administration intensified pressure on Israel this week to improve dire humanitarian conditions in the Gaza Strip, warning that the United States would be forced to undertake new actions — including a potential suspension of military assistance — if food and other aid to Palestinians is not increased within a month. The admonition, in a letter sent Sunday to the Israeli government, comes amid concerns over civilian deaths, along with dwindling access by aid groups to Gaza’s north. The letter’s authenticity was confirmed by U.S. and Israeli officials, speaking on the condition of anonymity to discuss sensitive communications between the two governments. Since the spring, the amount of aid delivered to Gaza “has dropped by more than 50 percent,” the United States says.”


7,238 posted on 10/15/2024 8:19:06 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7237 | View Replies]

To: PIF; All

More dependent on Gazprom. That will work out well.

“Hungary and Gazprom are discussing a 2025 deal for additional gas purchases, aiming to maximize the use of Turkish Stream for increased fuel volumes, says Hungarian FM Peter Szijarto.”

https://x.com/NOELreports/status/1846084254171545768


7,239 posted on 10/15/2024 8:20:21 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7238 | View Replies]

To: PIF; All

“SpaceX’s last ~40 hours:

- launch of history’s largest and most powerful rocket, Starship, completing the first-ever midair catch of a rocket booster and an on-target ocean landing of the upper stage

- launch of Falcon Heavy with an interplanetary NASA spacecraft headed to one of Jupiter’s moons, achieving a new Falcon vehicle velocity record

- two Falcon 9 launches of dozens of Starlink satellites; one from Florida, one from California

That’s four launches of three different rockets (Starship/FH/F9) from four unique launch sites in three U.S. states — in ~40 hours. Insanity.”


7,240 posted on 10/15/2024 8:27:07 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7239 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,201-7,2207,221-7,2407,241-7,260 ... 19,381-19,391 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson