Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,341-6,3606,361-6,3806,381-6,400 ... 19,381-19,391 next last

6,361 posted on 09/16/2024 7:23:29 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 6360 | View Replies]

To: JonPreston

dude thinks he’s the MFWIC, however, he’s just a pissant.


6,362 posted on 09/16/2024 7:26:46 AM PDT by going hot (Happiness is a Momma deuce)
[ Post Reply | Private Reply | To 6361 | View Replies]

To: going hot

Why did a construction worker, obsessed with Biden’s war in Ukraine, just try and assassinate the one guy who said he would end the war?


6,363 posted on 09/16/2024 7:37:44 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 6362 | View Replies]

To: JonPreston
Every human (well, most) are restrained by so called civility.

Remove that thin veneer, and we will act out our impulses, to their full extent.

That crazy sob did/does not feel that weight of civility.

6,364 posted on 09/16/2024 7:46:00 AM PDT by going hot (Happiness is a Momma deuce)
[ Post Reply | Private Reply | To 6363 | View Replies]

To: FtrPilot; blitz128

Kyiv Independent reports:

“The Danish government promised to transfer another batch of F-16 fighter jets to Ukraine later this year, the DR broadcaster reported on Sept. 15, citing Danish Defense Minister Troels Lund Poulsen.

“Denmark will deliver an additional contribution of F-16 aircraft in the second half of 2024,” Poulsen said in a comment to the Ritzau news agency after his visit to Kyiv.

Ukraine received its first U.S.-made fourth-generation jets in late July, one year after Denmark, the Netherlands, and other foreign partners launched the fighter jet coalition for Kyiv.

Danish Prime Minister Mette Frederiksen confirmed on Aug. 31 that these initial F-16s included aircraft from Denmark, while earlier reports suggested that the first batch was comprised of Dutch planes.

Copenhagen has pledged to deliver 19 aircraft to Ukraine in total…

…Ukraine was also promised 24 F-16s by the Netherlands, six by Norway, and 30 by Belgium. President Volodymyr Zelensky said his country needs at least 128 F-16s to successfully counter Russian air power.“


6,365 posted on 09/16/2024 7:47:16 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6352 | View Replies]

To: AdmSmith

Russia continues to expand its authorized standing Military headcount (authorized force structure). 140,000 more were authorized in 2022, another 170,000 in 2023, and 180,000 more were authorized today, taking the number of Military job positions (on paper) to about 1.5 million, up from about 1 million before the 2022 invasion.

Independent reports:

“Russian President Vladimir Putin signed a decree on Sept. 16 increasing the number of the Russian Armed Forces from roughly 2.2 million to 2,389,130 people, including 1.5 million military personnel.

The decree will take effect on Dec. 1, 2024, and will increase the total number of Russian military personnel and staff by 180,000...

…Ukraine believes that Russia continues to covertly recruit around 30,000 soldiers monthly, allowing the Russian military to balance out.”


6,366 posted on 09/16/2024 8:10:22 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6355 | View Replies]

To: SpeedyInTexas

Routh and Crooks both out of Central Casting.


6,367 posted on 09/16/2024 8:24:07 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 6351 | View Replies]

To: BeauBo
TASS, September 16. The Ministry of Internal Affairs has opened a criminal case on the theft of almost 1 billion rubles from the Ministry of Defense during the construction of a communications control center. As law enforcement agencies told TASS, the head of ERSM Siberia LLC, Roman Bezrukov, was detained as part of the case.

The agency's source said that a criminal case was opened for fraud on an especially large scale (Part 4, Article 159 of the Criminal Code of the Russian Federation) by the Main Directorate of the Ministry of Internal Affairs for Krasnoyarsk Krai. Bezrukov was detained by employees of the Main Directorate of Economic Security and Anti-Corruption of the Ministry of Internal Affairs of Russia together with their Krasnoyarsk colleagues.

The case materials available to TASS state that from May 2021 to March 2023, Bezrukov, together with other unidentified persons, transferred at least 993 million 812 thousand rubles into shadow circulation, conducting fictitious transactions under the guise of purchasing materials, performing work and providing services. The criminals withdrew the money through the bank accounts of legal entities affiliated with Bezrukov.

OOO ERSM Sibiri acted as a contractor under a contract concluded between the Russian Ministry of Defense and FSUE Main Military Construction Directorate No. 4 for the construction of the Defense Ministry's communications control center. The total value of the contract was 6.8 billion rubles. Under the terms of the contract, the contractor was obliged to perform design and survey and construction and installation work, but failed to fulfill its obligations. According to the case materials, due to failure to fulfill obligations, the contract was unilaterally terminated on March 1 last year. By that time, the facility was only 6% complete. If found guilty, the businessman faces up to 10 years in prison.

https://tass.ru/proisshestviya/21874311

On the positive side he will not be killed by the meat grinder.

6,368 posted on 09/16/2024 8:27:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6366 | View Replies]

To: AdmSmith

VIDEO

Ukrainian army hit with aerial bombs the house where Russian soldiers were gathered in Kursk
Kanal13
1.67M subscribers
9-16-2024 7:00 a.m.
Minutes 7:06
https://www.youtube.com/watch?v=gaqgDN3HI4w

“Ukrainian Armed Forces showed the
results of the ongoing shelling by the
Russian army in the KK region the
targets of which were residential areas.

RUSSIANS are burning RUSSIAN HOUSES
emphasized a Ukrainian soldier who
filmed the burning area on video a video
of Russian soldiers destroying the homes”


6,369 posted on 09/16/2024 6:31:53 PM PDT by UMCRevMom@aol.com (Pray for God 's intervention to stop Putin's invasion of Ukraine b.🇺🇸)
[ Post Reply | Private Reply | To 6357 | View Replies]

To: AdmSmith

At least not yet but he may yet get the opportunity to join the wave


6,370 posted on 09/16/2024 6:39:43 PM PDT by blitz128
[ Post Reply | Private Reply | To 6368 | View Replies]

To: marcusmaximus

You Glow just as brightly as they do.


6,371 posted on 09/16/2024 8:17:53 PM PDT by FlyingEagle
[ Post Reply | Private Reply | To 6367 | View Replies]

Russian Offensive Campaign Assessment, September 16, 2024

Russia continues to build out its long-term military capacity by gradually increasing the size of its armed forces. Russian President Vladimir Putin signed a decree on September 16 establishing the staffing level of the Russian Armed Forces at 1.5 million combat personnel.[15] This marks a 180,000-person increase from the last decree increasing the staffing level of the Russian Armed Forces, which Putin signed in December 2023.[16] The December 2023 decree increased the staffing level of combat personnel by 170,000 compared with August 2022, meaning that the target staffing level of the Russian military has expanded by around 350,000 combat personnel since 2022.[17] The September 16 decree will notably come into force on December 1, 2024, suggesting that Russian military authorities will increase recruitment and force-generation efforts to meet the 1.5 million combat personnel benchmark starting December 2024. This decree is notably not an indicator of a new wave of Russian mobilization — rather it encompasses the breadth of recruitment avenues that the Russian military is currently undertaking.[18] Former Russian Defense Minister Sergei Shoigu first set the 1.5 million combat personnel goal in December 2022, noting that this number includes a goal of 695,000 contract personnel.[19]

Russian efforts to increase the size of the armed forces are part of a longer-term Russian objective that extends beyond the war in Ukraine and aims to increase the size and overall capacity of the Russian military via long-term, large-scale force reforms. ISW has reported at length on these reforms, which have been ongoing since early 2023 and include the re-establishment of the Moscow and Leningrad military districts and the formation of new army corps, combined arms armies, and mechanized and airborne divisions.[20] Current Russian military reforms appear to be in large part reversing the main tenets of the reforms of former Russian Defense Minister Anatoly Serdyukov of 2008–2012, which decreased the size of the Russian armed forces from 1.3 million to 1 million combat personnel and tightened and centralized command and control (C2) by eliminating division–level echelons in favor of brigade-level units.[21] As the Russian military begins to stand up new divisions, army corps, and armies, its staffing level must increase in tandem, at least on paper. Russia's ability to properly implement these reforms and integrate the increase in combat personnel, however, is in part contingent on its prosecution of the war in Ukraine, as ISW has previously assessed.[22] Medium- to long-term force-generation and economic constraints will continue to degrade Russia's ability to sustain an increase in the size of its military and to soundly implement its intended reforms.[23]

Iran is simultaneously setting conditions to build a nuclear weapon while continuing to signal its willingness to resume nuclear negotiations with the West. NOTE: A version of this text appears in the September 16 ISW-CTP Iran Update. Russia has increased nuclear cooperation with Iran in recent months in line with “[Iranian] ambitions to obtain atomic weapons,” according to unspecified Western officials speaking to Bloomberg on September 14.[24] It is unclear whether the Western officials meant that Iran has decided to produce a nuclear weapon or that Iran seeks to develop the capability to develop a nuclear weapon but has not actually decided to produce one. The Western officials stated that US President Joe Biden and UK Prime Minister Keir Starmer discussed on September 13 how Russia may be sharing unspecified nuclear technology and secrets with Iran in return for Iran providing Russia with ballistic missiles.[25] Iran recently delivered over 200 Fateh-360 short-range ballistic missiles to Russia on September 4.[26] US Secretary of State Antony Blinken similarly stated on September 10 that “Russia is sharing technology that Iran seeks . . . including on nuclear issues.”[27] Russian President Vladimir Putin stated that Iran and Russia have increased “peaceful nuclear cooperation” during a meeting with Iranian Supreme National Security Council Secretary Ali Akbar Ahmadian in St. Petersburg, Russia, on September 12.[28]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-16-2024

6,372 posted on 09/17/2024 2:28:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6353 | View Replies]

To: PIF; BeauBo; gleeaikin; Monterrosa-24; SpeedyInTexas; blitz128; UMCRevMom@aol.com; marcusmaximus
earlier https://freerepublic.com/focus/news/4042550/posts?page=6561#6561

Russian blogger:

The birth rate in Russia is going to be increased by 3-4 times. This will take “not very much time”

Philosopher Alexander Dugin said this in a comment to our channel. He claims that he received a task from the Presidential Administration - to develop a set of measures to quickly increase the birth rate.

“Currently, a group of like-minded people and I are developing proposals. They will be submitted to Vladimir Vladimirovich for approval personally. There are fairly simple measures, for example, a ban on abortions, the fight against the vile ideology of childfree (this process has already begun , - ed.), restrictions on contraception, including a ban on some contraceptives, a ban on divorces (which Dugin himself initiated , - ed.), financial liability for childlessness. There are several more proposals that I will keep silent about for now. But they are bright, unconventional, fully consistent with the spirit of Russian culture, religion, and traditions. And they concern the upbringing of children, as well as the relationship between a man and a woman - both in marriage and before it,” Alexander Gelyevich told us.

At the same time, he refused to answer the question of whether any of the ideas for increasing the birth rate that we wrote about earlier would be implemented . In particular, regarding the special selection of women who will give birth to children for the state. “I am not ready to talk about this. I do not have the right yet,” Dugin explained. The Kremlin confirmed to us that they want to solve the problem of increasing the birth rate. And they believe that Dugin and his associates can express “several useful ideas” on this matter.

https://t.me/kremlin_secrets/4660

A new public variant of Lebensborn (literally: “Fount of Life”) was a secret, SS-initiated, state-registered association in Nazi Germany with the stated goal of increasing the number of children born who met the Nazi standards of “racially pure” and “healthy” Aryans, based on Nazi eugenics (also called “racial hygiene” by some eugenicists). Lebensborn was established by Heinrich Himmler, and provided welfare to its mostly unmarried mothers, encouraged anonymous births by unmarried women at their maternity homes, and mediated adoption of children by likewise “racially pure” and “healthy” parents, particularly SS members and their families.

https://en.wikipedia.org/wiki/Lebensborn

6,373 posted on 09/17/2024 2:49:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6372 | View Replies]


6,374 posted on 09/17/2024 2:53:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6322 | View Replies]


6,375 posted on 09/17/2024 2:54:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6355 | View Replies]

To: marcusmaximus

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Crimea is Shaking. Ukrainians Expel Russians From Oil Rig Bases ]


Today [ Sept 17 ], there are a lot of updates from Crimea.

Here, Russian forces renewed their efforts to undermine the Ukrainian grain corridor in the western Black Sea by taking advantage of their positions on drilling rigs and attacking a civilian cargo ship. Ukrainian commanders knew the importance of this move and decided to remove this danger by conducting an extensive amphibious operation to storm the Russian sea strongholds.

A series of successful strikes against the Russian Black Sea fleet has allowed Ukraine to secure the vital grain corridor through the Black Sea, crucial for economic recovery and global markets, particularly for countries in Africa and the Middle East.

Despite this, Russian forces have targeted Ukrainian port and grain infrastructure in the Odesa region to disrupt exports. Ukrainian Prime Minister Denys Shmyhal noted that 66,000,000 tons of cargo have been shipped in 2024, nearing pre-invasion levels.

To disrupt this, the Russian forces struck a civilian cargo ship transiting through the corridor in the western Black Sea, likely in a new attempt to undermine international confidence in its safety. Ukrainian officials reported that a cruise missile strike was conducted by the Russians against a civilian cargo ship under the flag of a 3rd country transporting wheat to Egypt exactly when leaving Ukrainian territorial waters, with preliminary data suggesting there were no casualties.

The Romanian Coast Guard reported later that the Russian missile struck the ship while in Romania’s maritime economic zone which once again showcases the provocative nature of this act.

Understanding the strategic significance of the grain corridor, Ukraine launched one of its largest amphibious operations, aiming to neutralize oil rig platforms that Russia had seized in 2014. Used as surveillance bases, they are crucial to Russian operations in the area.

Ukrainian naval forces, alongside elements of the Main Military Intelligence Directorate, executed a bold assault on the Crimea-2 drilling rig, utilizing 14 Willard Sea Force inflatable speed boats.

The operation’s detailed footage, later released, reveals the boats advancing rapidly toward the platform. Just before reaching their target, Ukrainian forces deployed a swarm of drones to strike enemy positions, effectively suppressing the defenders’ ability to retaliate. A Russian soldier later confirmed in an angry video that over 30 drones were used in the attack, resulting in significant losses among his fellow soldiers.

The footage further shows the boats closing in and unleashing a barrage from M2 Browning 12.7mm machine guns, followed by a series of powerful explosions on the platform. The Ukrainian forces then engaged in an intense firefight with the remaining Russian troops, demonstrating both tactical precision and overwhelming firepower in their assault.

The Russian forces reacted swiftly to the surprise attack by dispatching several fighter jets, including SU-30 and SU-35, to intercept the Ukrainian boats and prevent them from seizing the target. During this engagement, the Russian jets launched several missiles, but the situation took an unexpected turn when one of the SU-30 aircraft abruptly disappeared from radar.

Search and rescue operations were promptly initiated to locate the missing jet. Initially, the cause of the incident remained unclear, sparking various speculations in the Russian media. Some suggested the jet might have been downed by an F-16, while others considered the possibility of a technical malfunction or self-destruction.

However, Russian military bloggers soon reported that the aircraft was shot down by Ukrainian forces using a man-portable air defense system. According to these reports, the missile was fired from one of the Ukrainian speedboats involved in the assault, showcasing the Ukrainians’ capability to strike back even under challenging circumstances.

The Ukrainian Main Military Intelligence Directorate quickly confirmed the event by releasing footage of the operation. The video first shows the oil rig platform, with a Russian jet flying at low altitude, attempting to engage the Ukrainian forces at sea.

It then captures a boat maneuvering into position, followed by the launch of an air defense missile. Moments later later, the missile strikes the Russian aircraft leading to its destruction.

This precise and well executed hit not only shielded the Ukrainian assault group from a serious aerial threat, but also dealt a significant blow to the Russian forces, resulting in the loss of an aircraft valued at approximately US$50 million.

This incident further highlights Ukraine’s growing capability to counter Russian military assets, effectively demonstrating both tactical skill, and the ability to impose substantial costs on the adversary.

Overall, Ukraine’s bold assault on another oil rig platform underscores the strategic importance of safeguarding the grain corridor in the Black Sea.

By neutralizing enemy military positions and defending vital trade routes Ukraine not only reinforces its economic resilience, but also contributes to global food security.

The successful defense of the sea corridor sends a clear message about Ukraine’s capability and resolve in the face of ongoing threats against its maritime assets, and the flow of exports which plays an essential role in its wartime economy.


6,376 posted on 09/17/2024 4:23:12 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6367 | View Replies]

To: AdmSmith

As I have said before, what does being a nazi or neo-nazi actually mean these days?
What matters more is are your actions repeating what nazi germany did.

nazi Germany promoted the supremacy of its “race”, controlled the population through control of media, and a strong internal security apparatus. It invaded neighbors and considered its inhabitants untermensch…..

Now we can add “birthing homes” to the list

IMO, the country with the most similarities to the actions of nazi germany right now is Russia.


6,377 posted on 09/17/2024 4:38:35 AM PDT by blitz128
[ Post Reply | Private Reply | To 6373 | View Replies]

To: PIF
A Russian counterattack in Kursk that kicked off last week hasn’t made much headway but has worsened the Russian disposition - Forbes

As the media notes, not only did it fail to produce the desired result, but it aggravated the Russians' position in a potential pocket south of Korenevo.

According to Forbes, Kyiv has devoted about 10,000 soldiers in the Kursk region; Moscow, in turn, has sent 38,000 servicemen, but many of them are poorly trained young conscripts.

Meanwhile, the AFU has a new strategy in the Kursk region - to move quickly and encircle Russian troops.

Thus, last week, the AFU broke through the Russian defenses on a new section of the Russian-Ukrainian border near the village of Novy Put. And if they can link up with Ukrainian troops on the main stretch of the Ukrainian offensive, they will cut off potentially thousands of Russians between themselves and the border.

https://x.com/Gerashchenko_en/status/1835985601528541249


6,378 posted on 09/17/2024 4:55:51 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6376 | View Replies]

To: PIF; All

“”A confidential Ukrainian estimate from earlier this year put the number of dead Ukrainian troops at 80,000 and the wounded at 400,000, according to people familiar with the matter. Western intelligence estimates of Russian casualties vary, with some putting the number of dead as high as nearly 200,000 and wounded at around 400,000”

https://x.com/RALee85/status/1835929556177354852


6,379 posted on 09/17/2024 6:54:59 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6378 | View Replies]

To: PIF; All

Another satisfying day in America!

“Reportedly, this is a result of a cluster munition strike on a Russian training ground in Donetsk Oblast.”

https://x.com/wartranslated/status/1835984113792156146


6,380 posted on 09/17/2024 7:00:05 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6379 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,341-6,3606,361-6,3806,381-6,400 ... 19,381-19,391 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson