Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,461-5,4805,481-5,5005,501-5,520 ... 21,281-21,287 next last
To: AdmSmith
According to a poll conducted by the Public Opinion Foundation (FOM) on August 11, the level of dissatisfaction with the actions of the authorities among Russians has reached its highest level since the mutiny of Yevgeny Prigozhin in June 2023.

Against the backdrop of hostilities in the Kursk region, which began five days before the poll, 25% of respondents expressed outrage at the work of the authorities, which is only 1% lower than the figure recorded during the Prigozhin mutiny. Over the past week, the share of dissatisfied people has grown by 7%.

For comparison, a higher level of dissatisfaction was recorded in September 2022, when, against the backdrop of the announcement of mobilization, the number of dissatisfied people increased from 21% to 31% in three weeks. At the same time, the FOM study noted a significant increase in anxious moods among Russians. Over the past two weeks, the number of people experiencing anxiety has increased by 12%, reaching 45%. The proportion of those who describe their mood as “calm” fell from 59% to 48% over the same period.

https://t.me/kremlin_bulldogs/5190

5,481 posted on 08/19/2024 3:09:06 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5479 | View Replies]

To: AdmSmith

What are the sales of potato water these days, might be an even better indication of the Russian mir


5,482 posted on 08/19/2024 3:19:37 AM PDT by blitz128
[ Post Reply | Private Reply | To 5481 | View Replies]

To: BeauBo

I am “shocked” that wildberry didn’t report this “bad” news first 😎


5,483 posted on 08/19/2024 3:21:35 AM PDT by blitz128
[ Post Reply | Private Reply | To 5471 | View Replies]

To: blitz128

Wildberries began demanding money from Perm residents for delivery of goods.
https://ura.news/news/1052807159


5,484 posted on 08/19/2024 3:48:55 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5483 | View Replies]

To: marcusmaximus
"Shake on it Bub."

"No thanks"

GERMAN MP: UKRAINE MUST PAY FOR DAMAGE TO NORD STREAM PIPELINES

Alice Weidel has called for Ukraine to compensate Germany for the damage caused to its economy as a result of the attack:

“The economic damage to our country caused by the demolition of Nord Stream presumably… pic.twitter.com/RJEpnJIxgS— Mario Nawfal (@MarioNawfal) August 19, 2024

Alice Weidel has called for Ukraine to compensate Germany for the damage caused to its economy as a result of the attack:

“The economic damage to our country caused by the demolition of Nord Stream presumably ordered by Zelensky - and not Putin as we were led to believe - should be "billed" to Ukraine.”

Berlin-Kyiv relations were strained after the German Prosecutor General's Office issued an arrest warrant for a Ukrainian suspected of involvement in the pipeline sabotage.

5,485 posted on 08/19/2024 3:50:45 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5409 | View Replies]

To: AdmSmith

600,000 Milestone reached. Next: the 700,000 mark.


5,486 posted on 08/19/2024 3:55:05 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5476 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Checkmate. Russians Beg to Negotiate Returning of Thousands of Captured Conscripts ]


Today [ Aug 19 ], there are a lot of updates from the Kursk direction.

The most interesting news comes from the area of Korenevo. The Ukrainians successfully advanced around the town, achieving an operational encirclement and capturing 100s of Russian soldiers in the process. The situation with the prisoners became so critical that Russian officials requested negotiations for an exchange, aiming to recover over 2,000 newly captured Russian soldiers, most of whom were conscripts.

Ukrainian forces reached Korenevo several days ago, where the Russian command has concentrated most of their combat-ready troops in the region. Russian fighters predominantly concentrate in larger regional towns to defend against major Ukrainian assaults. However, due to their focus on protecting these larger cities, many villages and open areas remain unprotected, with most forces assigned to defend just Korenevo.

This has allowed Ukrainian sabotage and reconnaissance groups, along with larger mobile mechanized units, to advance through smaller villages surrounding Korenevo, effectively bypassing the Russian stronghold.

In this way, the Ukrainians significantly expanded their advance toward Korenevo, capturing the villages of Olgovka, Matvyevka, and Zhuravli to the north of the town. Additionally, Ukrainian forces seized control of Krasnooktyabrske and Komarovka to the south.

This expansion of Ukrainian-controlled territory on the flanks of Korenevo could lead to the encirclement of the Russian garrison, potentially forcing them into a withdrawal or mass surrender, as Russian defenses outside the town are minimal.

To disrupt Russian logistics and capture as many Russian soldiers as possible, elite fighters from the Ukrainian 82nd Assault Brigade and Special Forces Operators, ambushed Russian convoys on key supply routes.

Combat footage released by the 82nd Assault Brigade shows a small Ukrainian sabotage and reconnaissance group ambushing and destroying a convoy of 3 Russian supply trucks, armed only with small arms. The group also managed to capture several Russian soldiers who were part of the convoy.

Following the ambush, part of the Ukrainian unit withdrew to a nearby forest to change positions and prepare for a new ambush, while the main force remained to recover the wounded Russians and secure captured equipment.

The largest recent surrender of Russian troops occurred when 102 soldiers were captured by the Special Forces of the Security Service of Ukraine. Ukrainian Special Forces Operators uncovered a hidden underground bunker stocked with large quantities of ammunition and supplies, guarded by over a 100 Russian troops. Caught completely off guard and unprepared for battle, the Russian garrison decided to surrender.

Among the captured prisoners were members of the more professional Chechen Akhmat fighters. It’s likely that the Security Service of Ukraine, a highly capable intelligence agency, leveraged its extensive network of agents and informants to locate and infiltrate the bunker, leading to one of the largest single surrenders of Russian forces in the entire war.

To date, Ukrainian forces have captured over 2,000 Russian soldiers in Kursk, which President Zelensky has referred to as an exchange fund, suggesting the possibility of a future prisoner exchange with Russia.

The capture of such a large number of troops in Kursk has sparked controversy within the Russian public, as many of the captured soldiers were conscripts who had been deployed to Kursk for training, under the assumption that it was a safe location.

This situation led to groups of Russian conscript mothers, organized by NGOs, demanding the exchange of their sons for Ukrainian Azov fighters held in Russian captivity since the Battle of Mariupol.

Ukrainian Ombudsman Dmitry Lubinets noted that this marked the first time the Russian government had initiated negotiations for a prisoner exchange. Lubinets emphasized that the crisis with prisoners of war in Kursk had compelled Russia to take the initiative in addressing the issue for the first time.

Ukrainian officials had previously reported that Russian authorities had rejected Ukrainian proposals for prisoner exchanges. Ukrainian Military Intelligence Chief Kyrylo Budanov stated, that Ukraine will prioritize the return of seriously wounded and ill individuals, women, and those who have been in Russian captivity the longest.

In contrast, Russian officials have focused on negotiating the exchange of conscripts, who make up over 80% of the captives from the Kursk area.

Overall, the exchange of prisoners of war became the main concern of the Russian government to prevent potential protests and widespread social discontent.

Further losses of soldiers to Ukrainian captivity in the Kursk region, coupled with territorial losses, can risk loss of support for the war effort.

For the Ukrainians, the exchange of Russian prisoners of war for experienced as of veterans of Mariupol for Russian conscripts, can significantly bolster the fighting strength of the army, as many battle hardened soldiers and officers could once again engage in offensive and defensive operations, not only in Kursk, but across the whole front.


5,487 posted on 08/19/2024 3:59:08 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5465 | View Replies]

To: AdmSmith
Exactly 25 years ago, on August 17, 1998, Russia experienced one of the most severe economic crises in modern history. That day, a default on government bonds was announced. This led to a significant collapse of the ruble and inflation. In a few months, the national currency practically depreciated and Russians were left without money. Those who survived still remember that time with a shudder. URA.RU recalls, using photos as an example, the severe consequences of the economic crisis.

The Russian government and the Central Bank of the Russian Federation announced a technical default on the main types of government securities and a transition to a floating ruble exchange rate. The people visualized this by demonstrating scales with a ruble and a dollar. Demonstration of scales with Russian iron rubles and an American banknote with a face value of 1 dollar after a sharp jump in the exchange rate as a result of a technical default.

https://ura.news/news/1052806553

5,488 posted on 08/19/2024 4:02:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5484 | View Replies]

To: PIF

I’m so confused, wildberry is an “American patriot” who doesn’t give two shakes about Ukraine, that it is a European problem.

Yet he seems quite concerned about who destroyed the nordstream pipeline and what Europeans should do about it.

Curious


5,489 posted on 08/19/2024 4:10:17 AM PDT by blitz128
[ Post Reply | Private Reply | To 5486 | View Replies]

To: SpeedyInTexas

Ukraine Drops Key Russian Bridge In Kursk
While losing the bridge is a blow to Russia’s defense of Kursk, a key Ukrainian city in Donetsk may soon fall.
https://www.twz.com/news-features/ukraine-drops-key-russian-bridge-in-kursk

Clash Report@clashreport
Russia claims it destroyed two more Ukrainian MLRS (they think its HIMARS) in Sumy region.
https://x.com/clashreport/status/1824369889722671246


Jay in Kyiv@JayinKyiv
CNN reporter can’t believe how easily Ukraine is fully invading the Kursk region of Russia. [ Idiot reporter stands in road as vehicles swerve to avoid him. ]
https://x.com/JayinKyiv/status/1824489956506497336


Why Russians advance so quickly on the Pokrovsky direction
https://www.youtube.com/watch?v=0vr3FTe6kZI


Excerpt:
Pokrovsk and Toretsk may be priorities, but they are increasingly in danger of falling to Russia. However, the situation in Donetsk Oblast is becoming increasingly difficult for Ukraine under tremendous Russian pressure.

Russian troops are closing in on Pokrovsk, a key Ukrainian logistics hub, The New York Times reported, citing open-source battlefield maps, “casting doubts on Ukraine’s hopes that its new offensive into western Russia will prompt Moscow to scale back its attacks elsewhere on the battlefield.”

“After capturing several villages in the area and pushing along a railway line, Russian forces are now about eight miles from Pokrovsk, one of Ukraine’s main defensive strongholds in the Donetsk region, according to the maps, which are based on combat footage and satellite images.”

Capturing Pokrovosk would bring Russia “a step closer to its long-held goal of seizing the entire Donetsk region, much of which it already controls. Pokrovsk, a city with a prewar population of about 60,000, sits on a key road linking several cities that form a defensive arc protecting the part of Donetsk that is still held by Ukraine.”

“They have more ammunition, more people,” Mykhailo, a soldier of the 68th separate brigade, who “briefly but meaningfully explains the reasons for the rapid advances,” the outlet reported on YouTube.

“Russian forces continue to pursue a tactical encirclement of Ukrainian forces southeast of Pokrovsk and recently made confirmed advances in the area, the Institute for the Study of War said in its most recent assessment. “A Ukrainian soldier operating in the Pokrovsk direction stated on August 15 that Russian forces have a 10-to-1 infantry advantage in the area and conduct infantry-led assaults from just before sunrise to just after sunset each day. Another Ukrainian soldier stated that Russian forces are fewer than six kilometers from Selydove (southeast of Pokrovsk), which is consistent with ISW’s assessment of Russian advances in the area.”


Russia deploys fake Kilo-class submarine in Sevastopol with H.I. Sutton
https://www.navalnews.com/naval-news/2024/08/russia-deploys-fake-kilo-class-submarine-in-sevastopol/


5,490 posted on 08/19/2024 4:16:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5465 | View Replies]

To: blitz128

Confusing persona - claims it hurts his eyes to read long posts ( over one sentence ), yet he himself has posted multi-paragraph screeds.


5,491 posted on 08/19/2024 4:19:14 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5489 | View Replies]

To: AdmSmith

Putin and the Kremlin (but I repeat myself) banked on a quick smo, weak sanctions , and their national wealth fund to sustain them till this all blew over.

Since there was no plan b when plan a failed, smacking head against the wall is all they have. Russian mir allows for nothing else.

Getting Russian conscripts involved in this mess of their creation may turn out to be the most strategically significant thing the Ukrainians have done


5,492 posted on 08/19/2024 4:19:21 AM PDT by blitz128
[ Post Reply | Private Reply | To 5488 | View Replies]

To: PIF

Indeed, and spamming (to use his own words) multiple posts with same screeds

Certainly an indication of “high IQ”😎

Interesting no posts on latest “goodwill gestures “ from “failed” Ukrainian incursion into Kursk, fascinating


5,493 posted on 08/19/2024 4:23:13 AM PDT by blitz128
[ Post Reply | Private Reply | To 5491 | View Replies]

To: AdmSmith

Kremlin snuff box, 08/19/24
https://t.me/s/kremlin_secrets

The conflict with Akhmat in the Kursk region ended with the beating of the store owner

Alas, the unexpected cutting off of the Glushkovsky district from the rest of the Kursk region led not only to increasing panic, but also to the first conflicts with the military. The previous morning, a car with military personnel drove up to a local store to stock up on provisions. According to our information, these were Akhmat fighters who wanted to get food and water from local residents.

The seller ( who is also the owner ) refused to provide products to military personnel without any documents. The position, to be honest, is strange, but nonetheless. The dialogue escalated into a conflict, which ended in a serious beating of the store owner. The military nevertheless took away the food, and, according to local residents, they also took away the cash register that was in the store.

We understand everything - war. But I would like the Ministry of Defense and the Ministry of Internal Affairs to conduct an investigation into this fact. Our military personnel are not looters! We separately appeal to Apti Alaudinov - bring order to your ranks! It may happen that your resignation will happen even faster than many people think.


5,494 posted on 08/19/2024 4:23:51 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5484 | View Replies]

To: PIF

Seems to me the most important part of this is that the Russians are approaching the main defensive line, not have already overcome the main defensive lines, like Ukrainianshave in Kursk.

I am sure the Ukrainians have pulled troops from this front for Kursk, so the question is, is this a good gamble?

It appears the Russians are not doing the same and hope to achieve their goals by pushing attack and figuring they will deal with Kursk “in strength “ later.

Not sure that is going to work. They continue to lose manpower and equipment that they can ill afford, to take land that has little value. As they move their logistics get extended, and then they still have to take the stronghold.

Will they have the forces to do that, and at the same time “contain” the Kursk incursion before the political fallout becomes critical?

One other point, the further they move the more exposed their aircraft come to interception. I think one thing has become clear. Without aviation Russia doesn’t stand a chance.

I know, too( did I use that correctly wildberry?) many words. 😂


5,495 posted on 08/19/2024 4:41:39 AM PDT by blitz128
[ Post Reply | Private Reply | To 5490 | View Replies]

To: PIF

Russians sure have a lot of “investigations” to deal with😎


5,496 posted on 08/19/2024 4:42:42 AM PDT by blitz128
[ Post Reply | Private Reply | To 5494 | View Replies]

To: PIF
I don’t know what the firefighters are doing at the Rostov oil depot but that thing seems to be burning worse than yesterday.

https://x.com/NAFORaccoon/status/1825492951184654434


5,497 posted on 08/19/2024 5:33:42 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5494 | View Replies]

To: PIF
Another massive secondary explosion occurred in the oil depot of Proletarsk, Rostov region, in Russia.

Russian channels frantically screaming for help.

https://x.com/Tendar/status/1825512996216373353

My guess is the underground pipes are not deep enough.

5,498 posted on 08/19/2024 5:45:18 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5497 | View Replies]

To: BeauBo; PIF; SpeedyInTexas; AdmSmith; blitz128; FtrPilot; Monterrosa-24; popdonnelly; BroJoeK; ...

Here is a link saying/showing that the third bridge across the Seym/Seim River in Kursk has been hit/destroyed(?).

https://www.rferl.org/a/ukraine-russia-shelling-kursk/33083897.html

The detailed article at this link reports, “Analysts say taking out bridges over the Seym is crucial for Ukraine to ensure a secure flank to its offensive in Kursk by making it difficult for Moscow to supply its troops south of the river.” Apparently all 3 bridges are now useless if other reports are accurate.

Please note, putting “All” in the “To” line does not contact ANYBODY. Pings are only sent to actual names listed there.


5,499 posted on 08/19/2024 6:51:06 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5480 | View Replies]

To: PIF; AdmSmith; SpeedyInTexas; blitz128; BeauBo; FtrPilot

600,000 casualties, next 700,000.

With at least 30,000 casualties a month, but probably closer to 35,000, 700k could be reached by Thanksgiving, but almost certainly by New Year’s day. Thus cause for a grim celebration either of Thanksgiving, or of hopes for the New year.

Alas, for many families in Russia it will be a tragic milestone. Only hope is strong moves towards ending this insanity. I hope the families who are victims of leadership megalomania will have the courage to demand rational action.


5,500 posted on 08/19/2024 7:42:01 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5486 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,461-5,4805,481-5,5005,501-5,520 ... 21,281-21,287 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson