Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,221-5,2405,241-5,2605,261-5,280 ... 21,501-21,504 next last
To: ETCM
It appears that the drones are ingressing at an altitude where small arms (AK-47) cannot reach them.

They then dive at a relatively steep angle so the only guns that can shoot them down have to be located at or near the target.

5,241 posted on 08/14/2024 2:33:04 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 5240 | View Replies]

To: FtrPilot
They then dive at a relatively steep angle so the only guns that can shoot them down have to be located at or near the target.

And unless ground fire disables the warhead, it will still land in or near the target area. Unless high precision is required, it can still succeed in damaging or destroying the target. I think the first time I saw video of these drones was the attack on Novorossiysk last month, but they might have had them longer.

5,242 posted on 08/14/2024 3:05:31 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 5241 | View Replies]

To: ETCM

I thought it was interesting that wildberry brought this up instead of “crushing blow” Russia had had on Kursk “terrorist act” lol

I do actually wonder how much Putin knows. Russian mir is an amazing condition but for him to cry about civilians being killed and property destroyed is even over the top for him


5,243 posted on 08/14/2024 4:00:32 PM PDT by blitz128
[ Post Reply | Private Reply | To 5239 | View Replies]

To: SpeedyInTexas

Not sure why wildberry thinks he has a gotcha on us, xiden is no friend to most of us.
First nordstream and now Afghanistan debacle, poor guy must be in one hell of a funk


5,244 posted on 08/14/2024 4:06:17 PM PDT by blitz128
[ Post Reply | Private Reply | To 5237 | View Replies]

To: FtrPilot; All

Send some to Ukraine

“U.S. Navy’s newest air-to-air missile could tilt balance in South China Sea”

“The U.S. Navy’s deployment of new extremely long-range air-to-air missiles in the Indo-Pacific could erase China’s advantage in aerial reach, experts say, part of an intensifying focus on projecting power amid high tensions in the region.

The AIM-174B, developed from the readily available Raytheon (RTX.N), opens new tab SM-6 air defence missile, is the longest-range such missile the United States has ever fielded and was officially acknowledged in July.

It has three key advantages: it can fly several times farther than the next-best U.S. option, the AIM-120 AMRAAM; it does not require new production lines; and it is compatible with the aircraft of at least one ally, Australia.

Crucially, a weapon such as the AIM-174B, which can attack aerial targets as far away as 400 km (250 miles), outranges China’s PL-15 missile, allowing U.S. jets to keep threats farther from aircraft carriers, and safely strike “high-value” Chinese targets, such as command-and-control planes.”

https://www.reuters.com/world/us-navys-newest-air-to-air-missile-could-tilt-balance-south-china-sea-2024-08-14/


5,245 posted on 08/14/2024 4:23:00 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5242 | View Replies]

To: SpeedyInTexas; FtrPilot

There were a few pics a while back that showed what appeared to be an SM-6 under the wing of an F-18E, so we knew they were at least doing some kind of testing. This is an incredible missile. It also doubles as a strike missile, including anti-ship, and the US Army is buying them for their new Typhon system. The newest version is most likely hypersonic in strike mode, possibly A2A too. And the AIM-260 should be coming soon.

https://www.twz.com/air/aim-174-super-hornet-launched-variant-of-sm-6-missile-breaks-cover-in-hawaii


5,246 posted on 08/14/2024 5:30:44 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 5245 | View Replies]

To: PIF; All

“Another large Russian group of 30 people surrendered in Kursk.”

https://twitter.com/wartranslated/status/1823852307341295702


5,247 posted on 08/14/2024 6:55:25 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5246 | View Replies]

To: FtrPilot; marcusmaximus; Paul R.; Bruce Campbells Chin; PIF; familyop; MercyFlush; tet68; BeauBo; ..

Ukraine ping

[It appears that the drones are ingressing at an altitude where small arms (AK-47) cannot reach them.
They then dive at a relatively steep angle so the only guns that can shoot them down have to be located at or near the target.]


The vast majority of drones are allegedly shot down or disabled. My impression from the ones in the publicly available videos - which don’t usually show the misses - is that the successful ones either catch their victims unawares, away from their weapons or with no ammunition left. To defend against them, you need to take turns watching the skies, have your weapon on you, rifle or sidearm, at all times and keep a reserve of ammo for fending them off. I’ve never seen this in operation, but timed just right, a grenade hurled in its path, followed by a dive for cover, might be a viable last ditch defense. Not great, but maybe better than nothing, when no other options are left.


5,248 posted on 08/14/2024 6:59:47 PM PDT by Zhang Fei (My dad had a Delta 88. That was a car. It was like driving your living room)
[ Post Reply | Private Reply | To 5241 | View Replies]

To: PIF; All

“EXCLUSIVE: A Drunken Evening, a Rented Yacht: The Real Story of the Nord Stream Pipeline Sabotage”

“Private businessmen funded the shoestring operation, which was overseen by a top general; President Zelensky approved the plan, then tried unsuccessfully to call it off”

“It was the kind of outlandish scheme that might bubble up in a bar around closing time.

In May of 2022, a handful of senior Ukrainian military officers and businessmen had gathered to toast their country’s remarkable success in halting the Russian invasion. Buoyed by alcohol and patriotic fervor, somebody suggested a radical next step: destroying Nord Stream.

After all, the twin natural-gas pipelines that carried Russian gas to Europe were providing billions to the Kremlin war machine. What better way to make Vladimir Putin pay for his aggression?
Just over four months later, in the small hours of Sept. 26, Scandinavian seismologists picked up signals indicating an underwater earthquake or volcanic eruption hundreds of miles away, near the Danish island of Bornholm. They were caused by three powerful explosions and the largest-ever recorded release of natural gas, equivalent to the annual CO2 emissions of Denmark.
One of the most audacious acts of sabotage in modern history, the operation worsened an energy crisis in Europe—an assault on critical infrastructure that could be considered an act of war under international law. Theories swirled about who was responsible. Was it the CIA? Could Putin himself have set the plan in motion?

Now, for the first time, the outlines of the real story can be told. The Ukrainian operation cost around $300,000, according to people who participated in it. It involved a small rented yacht with a six-member crew, including trained civilian divers. One was a woman, whose presence helped create the illusion they were a group of friends on a pleasure cruise.

“I always laugh when I read media speculation about some huge operation involving secret services, submarines, drones and satellites,” one officer who was involved in the plot said. “The whole thing was born out of a night of heavy boozing and the iron determination of a handful of people who had the guts to risk their lives for their country.””

https://archive.ph/Z0XgG


5,249 posted on 08/14/2024 7:28:26 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5247 | View Replies]

To: SpeedyInTexas

Ukrainian long-range drones hit four Russian airbases overnight on Aug. 14 in the largest attack on airfields in the war, a source in the Security Service of Ukraine (SBU) told the Kyiv Independent.

Earlier the same day, Russia claimed it had downed over 110 Ukrainian drones in a massive strike, with local Telegram channels reporting explosions at the Savasleyka, Borisoglebsk, and Voronezh’s Baltimore airbases. The SBU source said the attacks targeted the three aforementioned airbases, as well as an airbase in Kursk.

The strike targeted fuel and lubricant warehouses and aerial ammunition, but the full consequences remain unclear, the General Staff said.
https://kyivindependent.com/ukraine-hit-4-russian-airbases/


5,250 posted on 08/14/2024 11:37:03 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5249 | View Replies]

To: AdmSmith

How Ukraine Caught Putin’s Forces Off Guard in Kursk — And Why
The attack on a portion of the Russian region represents the largest seizure of the country’s land since WWII

A Ukrainian source close to the military with firsthand knowledge of the operation told New Lines that the invading troops were shocked by how many prisoners of war they were able to capture on the Russian side and at the initial ease of their breakthrough across the border.

All of Russia’s legal national boundaries are controlled by the FSB Border Guard, officers of which vanished during the assault. Russian troops — almost all of them conscripts — had no idea their enemy was on the march, according to a senior Western diplomat. “Many just laid down their arms and fled,” said the diplomat, who spoke to New Lines on condition of anonymity. “The initial incursion was mounted with a strike force of only 2,000 or so. They wiped out 20 Russian trucks coming to the rescue.”

xxx

“In order to change the course of the war, we need to resort to nonstandard steps,” Serhii Kuzan, the chair of Ukrainian Security and Cooperation Center and ex-adviser to the Ukrainian Ministry of Defence, told New Lines. “This is the principle of asymmetric warfare. We cannot wage a symmetrical war, because there are simply more Russians.”

https://newlinesmag.com/spotlight/how-ukraine-caught-putins-forces-off-guard-in-kursk-and-why/


5,251 posted on 08/15/2024 12:57:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5250 | View Replies]

WSJ article on how Nord Stream was blown up is a screenplay for a Hollywood movie.

Main takeway from WSJ report; Ukraine Ambassador to UK blew up NS, he denies it. Zelensky flip-flopped on the idea, CIA knew it was being planned and Germany is too afraid to blame Ukraine.

⬇️ WSJ: "In May of 2022, a handful of senior Ukrainian military officers and businessmen had gathered to toast their country’s remarkable success in halting the Russian invasion. Buoyed by alcohol and patriotic fervor, somebody suggested a radical next step: destroying Nord Stream."

"Now, for the first time, the outlines of the real story can be told. The Ukrainian operation cost around $300,000, according to people who participated in it. It involved a small rented yacht with a six-member crew, including trained civilian divers. One was a woman, whose presence helped create the illusion they were a group of friends on a pleasure cruise."

👉Zelensky initially approved the plan, but later, when CIA learned of it and asked him to pull the plug, he ordered a halt. Zaluzhny, who was leading the effort, ignored Zelensky's order to halt the operation.

👉“An attack of this scale is a sufficient reason to trigger the collective defense clause of NATO, but our critical infrastructure was blown up by a country that we support with massive weapons shipments and billions in cash,” said a senior German official.

Cherry on top of this s*it cake:

German investigators had "one lucky break. In rushing to leave Germany, the sabotage crew neglected to wash the Andromeda, allowing German detectives to find traces of explosives, fingerprints and DNA samples of the crew."

https://wsj.com/world/europe/nord-stream-pipeline-explosion-real-story-da24839c


5,252 posted on 08/15/2024 2:47:01 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5234 | View Replies]

To: AdmSmith

🇺🇦ZELENSKY APPROVED PLAN TO BLOW UP NORD STREAM PIPELINES

Despite the mainstream media saying for months that Russia blew up the pipelines, the Wall Street Journal has now revealed it was planned and executed by Ukraine at a cost of $300,000.

When the CIA learned of the plan… pic.twitter.com/toNZ3xwGRf— Mario Nawfal (@MarioNawfal) August 15, 2024


5,253 posted on 08/15/2024 2:50:06 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5251 | View Replies]

To: SpeedyInTexas

Sergej Sumlenny, LL.M@sumlenny

A great joke from Russia.

Putin, after 10 days of Kursk catastrophe, summons Stalin’s ghost:

Stalin: “What’s happened?”

Putin: “Nazis are at Kursk! My army is beaten! What should I do?”

Stalin: “Do like me 1943. Send best Ukrainian troops to the front, and ask the US for arms!”


5,254 posted on 08/15/2024 3:39:08 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5249 | View Replies]

To: PIF

https://x.com/sumlenny/status/1823316593364832487


5,255 posted on 08/15/2024 3:42:58 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5254 | View Replies]

To: SpeedyInTexas


5,256 posted on 08/15/2024 3:44:33 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5249 | View Replies]

To: PIF

Apparently wildberry is really concerned about a Russian pipeline and what happened in Europe
I thought he/she/it was all about Merica?
Hummm

Really miss his updates on muskovite crushing Ukrainian “insurrection”/s


5,257 posted on 08/15/2024 3:47:42 AM PDT by blitz128
[ Post Reply | Private Reply | To 5254 | View Replies]

To: SpeedyInTexas

Interesting stories:

Russia Building Trenches In Kursk To Defend Against Ukrainian Advances
As Ukrainian forces in Kursk push northward, Russia is adding trenches in addition to troops to defend its territory.
https://www.twz.com/news-features/russia-building-trenches-in-kursk-to-defend-against-ukrainian-advances


Best Look Yet At Ukrainian MiG-29 Releasing Hammer Rocket-Assisted Bombs
The video shows a now deceased Ukrainian MiG-29 pilot executing a toss release of the French-made weapons.
https://www.twz.com/air/best-look-yet-at-ukrainian-mig-29-releasing-hammer-rocket-assisted-bombs


Ukrainian Drone Seen Slamming Into Russian Air Base In Large-Scale Strikes On Multiple Installations
Three Russian air bases were apparently struck in what may well have been the biggest Ukrainian drone strike of its kind so far.
https://www.twz.com/air/ukrainian-drone-seen-slamming-into-russian-air-base-in-large-scale-strikes-on-multiple-installations


Kursk Invasion Plan Developed By Lessons Learned From Failed Counteroffensive: Retired Ukrainian Officer
A retired high-ranking officer’s thoughts on how Ukraine changed its tactics for the Kursk invasion and the goals of the operation.
https://www.twz.com/news-features/kursk-invasion-plan-developed-by-lessons-learned-from-failed-counteroffensive-retired-ukrainian-officer


The coolest Navy Captain, USS Dwight D. Eisenhower

Carrier Captain On How His Up-Beat Tweets Would Have Needed To Change If Houthi Missiles Struck His Ship
Navy Captain Chris “Chowdah” Hill opens up about the triumphs and tribulations of tweeting while in command of a supercarrier in combat.
https://www.twz.com/news-features/carrier-captain-on-how-his-up-beat-tweets-would-need-to-change-if-houthi-missiles-struck-his-ship


5,258 posted on 08/15/2024 3:53:47 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5249 | View Replies]

To: Zhang Fei

It appears that Russians are using more and more shotguns to some effect.

Down side exploding a drone that close is not exactly without consequences

To your tag line, a friend of mine used to love to read the blue book descriptions

On a Cadillac it read you don’t park it you dock it
And on a muscle car it read you can pass everything on the highway except a gas station


5,259 posted on 08/15/2024 3:54:39 AM PDT by blitz128
[ Post Reply | Private Reply | To 5248 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Massive Onslaught: Unlimited Shells vs. Russian Human Wave Attacks ]


Today [ Aug 15 ], there are a lot of developments in the Kursk region.

As Ukrainians had penetrated deep into Russian territory, Russians transferred a large number of reserves to the area to respond to the quickly deteriorating situation. In response, Ukrainians used a genius tactic to delay these Russian reinforcements.

Ukrainians, most of whom can speak Russian without accent, called up Russian civilians in the area, ordering them to evacuate by posing as Russian officials. This caused large traffic jams on the main roads Russians were using to transfer military equipment over, severely delaying the Russian response time to the quickly developing situation.

Ukrainians also sent smaller reconnaissance groups far behind Russian lines to conduct ambushes, sabotage, and report on larger Russian troop movements before directing strikes to destroy the Russian convoys. The Russian media even incidentally helped Ukrainians with this task, broadcasting live on troop movements in a media stunt to improve morale and hold up the façade that everything was under control.

Russian military bloggers protested on masse, saying that this was one of the biggest problems in the Russian military, as the commanders continue to live in an illusion while ignoring reality, leading to disastrous consequences.

Unfortunately for Russians, these military bloggers were right, as Ukrainians managed to identify major Russian logistic routes and forces concentrations meant to stop the Ukrainian advance. Ukrainians later released footage of them hitting one of these convoys with a series of high-precision HIMARS strikes.

Russian civilians who were evacuating the area recorded the aftermath of the strike, showing dozens of burnt-out or otherwise destroyed logistic trucks filled with hundreds of Russian troops.

Besides conscripts and emergency reserves, Russians also deployed Chechen Akhmat special forces to the area to help stabilize the region and dissuade Russian soldiers from surrendering. As it turns out, after Ukrainians defeated the initial Russian defenders, they went on to strike hard against the Chechen barrier troops. Russian soldiers then posted on Telegram how these Chechen units fled the battlefield as soon as they came under Ukrainian fire or immediately surrendered.

These Russian whistleblower soldiers were, however, arrested by the Chechen units and forced to publicly state they were lying and praise the Akhmat soldiers. Ukrainians, in turn, posted videos of having captured large numbers of these Chechen fighters, waiting for Ukrainian transport vehicles to take them into Ukraine.

As Ukrainian sabotage groups effectively delayed many Russian reinforcements, the Russian lines remained thin, allowing Ukrainians to continue to push much deeper into the region. Russian forces shared geolocated footage of a failed Iskander ballistic missile strike on a Ukrainian armored assault group. However, the footage shows the missile had completely missed its target, leaving the only visible Ukrainian armored vehicle operational.

Russian sources state the Ukrainian assault group was operating in the area with over 10 armored vehicles and had launched an attack on the settlement of Kachuk, indicating that Ukrainians had severely expanded their area of control northward. Next, the Russian Ministry of Defense stated that they were targeting Ukrainians with artillery, drones, and aviation above the Krepna River.

Russian sources also state that Ukrainians had taken control of the settlement of Olgovka. As Ukrainians had active assault groups operating above the river, Ukrainians have likely taken control over both crossing points over the river. Russians additionally state Ukrainians advanced in the forests northwest of Liubimovka.

Ukrainians also launched a series of attacks toward the east, advancing toward Cherkasskoe Porechnoe and capturing the settlement. Russians conducted a series of Lancet drone strikes against Ukrainian armored vehicles here, destroying some, but leaving the infantry intact to take up positions in the houses.

As you remember, from the last report, Ukrainians took control over the western part of the Russian settlement of Sudzha. Yesterday launched a pincer maneuver on the settlement to take the Russians into a pocket. Ukrainians launched a two-prong attack in the north and crossed the river in the South.

The latest geolocated footage shows that Ukrainians took complete control of the critical intersection northeast of the town and moved south into the settlement, freely traversing the roads here under no threat of Russian fire.

This confirms that the offensive was successful and Russians either retreated from the town or were encircled and taken captive. Both Russian and Ukrainian sources reported that Ukrainians had advanced along the border as well consolidating control over the ?Guavo? area crossing the river and taking the settlement of Bobrova.

Ukrainians also continue to conduct reconnaissance operations deep behind Russian lines to the east to report on Russian troop movements and test the strength of Russian defenses here.

Interestingly enough Russian geolocated footage shows Ukrainian armored vehicles making it as far as 30 km behind the Russian lines, before they were stopped.

This indicates that the Russian Eastern flank is just as thinly meant as the locations where Ukrainians initially crossed the border and that all available reserves in the area were transferred to the West in an attempt to stabilize the situation.

Overall, the tempo of the Ukrainian advance is not slowing down as Ukrainians continue to reinforce their spearhead into the Kursk region.

Ukrainians are actively looking for more weak spots by continuously testing Russian defenses even getting as far as 30 km behind Russian lines.

These Ukrainian reconnaissance missions have exposed a considerable weakness in the Russian flanks as these vast areas seem only to be lightly defended by only small groups of infantry.

With most, if not all, Russian reserves rushing toward the initial Ukrainian spearhead across the border and Ukrainians still holding many forces in reserve, we will likely see more Ukrainian incursions further stretching out the already thin Russian front line.


5,260 posted on 08/15/2024 4:19:27 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5249 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,221-5,2405,241-5,2605,261-5,280 ... 21,501-21,504 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson