Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 22,421-22,44022,441-22,46022,461-22,48022,481-22,492 next last
To: JonPreston

And I am sure the Russians are just limited to X
Stay focused
Russian not Russia couldn’t care less😂😂😂😂


22,441 posted on 11/25/2025 6:43:27 PM PST by blitz128
[ Post Reply | Private Reply | To 22440 | View Replies]

Day 1,369 of the Muscovian invasion. 1,120 [average is 852] i.e. more than 46 Russians, Norks and Cubans/h. Vehicles and fuel tanks more than 125% above average.




22,442 posted on 11/26/2025 2:05:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22388 | View Replies]

To: PIF; BeauBo; blitz128; gleeaikin; Dot; adorno; Timber Rattler; SpeedyInTexas; dennisw; GBA
Russian Offensive Campaign Assessment, November 25, 2025

The Trump administration continues efforts to negotiate a peace deal to end Russia's war against Ukraine. US President Donald Trump stated on November 25 that Ukraine and the United States “fine-tuned” the initially proposed 28-point peace plan with additional input from Ukraine and Russia and that there are “only a few” remaining points of disagreement.[1] Trump stated that he directed US Special Envoy to the Middle East Steve Witkoff to meet with Russian President Vladimir Putin in Moscow and US Army Secretary Daniel Driscoll to meet with a Ukrainian delegation at an unspecified location.[2] Trump stated that he looks forward to meeting with Ukrainian President Volodymyr Zelensky and Putin “soon,” but only when the peace deal is “final” or “in its final stages.”[3] Lieutenant Colonel Jeff Tolbert, Driscoll’s spokesperson, stated that Driscoll and his team spoke with a Russian delegation in Abu Dhabi on November 24 and 25.[4] Axios and ABC reported that sources stated that Ukrainian Main Military Intelligence Directorate (GUR) Head Lieutenant General Kyrylo Budanov was also in Abu Dhabi, but it is unclear whether Budanov met with the Russian delegation or just the American one.[5]

Ukrainian officials continue to express support for the latest 19-point peace plan and demonstrate Ukraine's willingness to engage in further talks. Ukrainian Presidential Office Head Andriy Yermak told Axios on November 25 that US and Ukrainian officials have agreed in principle on most aspects of the latest peace proposal and that Zelensky wants to negotiate territorial concessions with Trump directly.[6] Yermak stated that the updated draft text on security guarantees “looks very solid” and that the United States had a “positive reaction” to the prospect of enshrining the security guarantees for Ukraine in a formal treaty. Ukrainian National Security and Defense Council Secretary Rustem Umerov stated that Ukraine is looking to organize a meeting between Zelensky and Trump in Washington in November 2025 to complete the final steps and “make a deal” with Trump.[7] The Financial Times (FT) reported that senior Ukrainian officials stated that Trump and Zelensky would decide on the most sensitive issues in the proposed peace deal, such as territorial issues and US security guarantees for Ukraine, but noted that Ukraine agreed to cap its military at 800,000 personnel.[8] Ukraine has roughly 900,000 active servicemembers.[9]

Russian officials are attempting to exploit the lack of clarity about the outcome of the August 2025 US-Russian Alaska summit to conceal the Kremlin's continued unwillingness to compromise and its commitment to its maximalist demands. Russian Foreign Minister Sergei Lavrov claimed on November 25 that the Russian stance towards the peace proposals will “fundamentally” change should the updated peace plan “erase” the “spirit and letter” of alleged agreements from the Alaska summit.[10] Russian State Duma International Affairs Committee Chairperson Leonid Slutsky reiterated Russia's call for any peace settlement to address the war's “root causes”- a deliberately vague term that the Kremlin has long used as shorthand for its original war justifications and demands – and claimed that Russia reached an “understanding” with the United States at the Alaska summit.[11] The exact parameters of the US-Russian discussions at the Alaska summit remain unclear, and the parties did not issue official statements about any agreements they reached during the summit.[12] Putin used the press conference at the Alaska summit to reiterate his demands about the “root causes,” and Russian Foreign Minister Sergei Lavrov spoke to several Russian and US media outlets directly after the summit to clarify to the West that Russia's demands to end the war had not changed.[13] High-ranking Russian officials, including Putin, have responded to the various peace plan proposals in recent days by reiterating their commitment to alleged US-Russian agreements from the Alaska summit.[14] The Kremlin has previously pointed to the 2022 Istanbul agreements, which clearly and publicly documented Russia's maximalist demands for Ukraine's capitulation, as their preferred basis of any future agreements.[15] The Kremlin appears to now be exploiting the lack of official, publicly available agreements from the Alaska summit to appear as a good-faith participant in negotiations and is willing to compromise on its original war demands. Kremlin officials’ continued public rejections of the US- and Ukraine-proposed peace plans and repeated statements about the “root causes” of the war, however, demonstrate that the Kremlin remains committed to its original war aims from 2021 and 2022. Russian ultranationalist milbloggers, a key pro-war constituency for Putin, also continued to reject the peace proposals on November 25 and advocate that Russia continue the war, further demonstrating how the Kremlin has failed to set conditions for the Russian people to accept anything less than a full Russian victory in Ukraine.[16]

The Washington Post reported on November 25 that a former senior Kremlin official with knowledge of the negotiations acknowledged that the initial 28-point peace plan was a “pro-Russian plan” but stated that some elements of the plan were still unacceptable for Russia.[17] A Russian academic close to senior Russian diplomats told the Washington Post that the 28-point plan was “not good enough” for Russia as it did not address the Kremlin's longstanding demands to remove the current democratically elected Ukrainian government and demilitarize Ukraine by crippling Ukraine's military capacity. The Russian academic claimed that Putin likely does not want Trump to see him as the “main obstacle to peace,” but that it is unclear how flexible Putin will be and on what issues he will yield. The source claimed that Putin's position likely hinges on his view of Russia's “reserves of stability” in the face of growing sanctions pressure and that Putin may take a more flexible position if he thinks that “problems are building and next year will be more difficult” for Russia. ISW continues to assess that Russia will likely face a series of military and economic issues in the medium-term and that the United States can leverage economic measures coupled with weapons sales to Ukraine to push Putin to come to the negotiating table ready to make compromises to end the war.[18]

Russia killed at least seven Ukrainian civilians and injured at least 20 in Kyiv City and struck Ukrainian energy infrastructure during combined missile and drone strikes on the night of November 24 to 25. The Ukrainian Air Force reported that Russian forces launched 22 missiles and 464 Shahed-type, Gerbera-type, and other drones, and that 26 missiles and drones struck 15 locations and falling debris hit 12 locations.[19] The Ukrainian Air Force specified that Russian forces launched four Kh-47M2 Kinzhal aeroballistic missiles; three Iskander-M ballistic missiles; eight Kalibr and seven Iskander-K cruise missiles; and about 250 Shahed drones. The Ukrainian Air Force reported that Ukrainian forces downed one Kinzhal, three Iskander-M, five Iskander-K, and five Kalibr missiles and 438 drones. Ukrainian officials reported that Russian forces struck energy infrastructure in Kyiv City and Kyiv, Odesa, Chernihiv, Dnipropetrovsk, and Kharkiv oblasts; and stated that the government will impose rolling blackouts across Ukraine starting on November 26 due to reduced power generation.[20] The Ukrainian Energy Ministry reported that the November 24 to 25 strikes left over 102,000 Ukrainian energy consumers without power.[21] Ukrainian officials, including Ukrainian President Volodymyr Zelensky, reported that Russian forces primarily targeted Kyiv City and Kyiv Oblast and that Russian strikes against residential buildings and a supermarket warehouse killed seven and injured 20 people in Kyiv City.[22] Ukrainian officials reported that Russian strikes also damaged port infrastructure in Chornomorsk, Odesa Oblast and civilian infrastructure elsewhere in the oblast, injuring six civilians.[23] Ukrainian officials reported that Russian forces also struck Ukrzaliznytsya railway energy infrastructure in Nova Vodolaha, Kharkiv Oblast and civilian infrastructure in Chernihiv, Sumy, Cherkasy, and Dnipropetrovsk oblasts.[24]

Russian drones violated Romanian and Moldovan airspaces on the night of November 24 to 25 during combined missile and drone strikes against Ukraine. The Romanian Ministry of National Defense detected two drones over Romania's Tulcea and Galați counties (both in southeastern Romania) about an hour apart on the morning of November 25 and reported that NATO scrambled two German Eurofighter Typhoon aircraft and two F-16 aircraft to intercept the drones.[25] The Romanian Ministry of National Defense stated that fighter jets tracked the first drone until it reentered Ukrainian airspace and that the second drone was moving towards the Vrancea County, over 100 kilometers away from the Romanian-Ukrainian border.[26] Romanian Defense Minister Ionut Mosteanu stated that the fighter jets nearly shot down the second drone, which repeatedly entered Romania's airspace, but held off due to concerns of debris causing damage on the ground.[27] Mosteanu stated that Romanian authorities later found a Russian drone without an explosive device in Vaslui County (about 250 to 300 kilometers from Ukraine) in what may be the deepest violation of Romanian airspace since February 2022, emphasizing that Romania is facing a “new Russian provocation.”[28] Moldova's Ministry of Defense (MoD) reported that six Russian drones violated Moldovan airspace overnight, and Moldovan Police reported that a Russian Gerbera drone crashed into a house in Cuhurestii de Jos, northern Moldova.[29] Moldova's Ministry of Foreign Affairs (MFA) summoned the Russian ambassador over the drone incursions on November 25.[30]

The situation in the Pokrovsk direction remains serious and dynamic as Russian forces continue to leverage their new offensive template to seize Pokrovsk and encircle Ukrainian forces in Myrnohrad (east of Pokrovsk). ISW has previously assessed that Russia's new offensive template is comprised of heavy battlefield air interdiction (BAI) efforts and infiltration tactics.[31] Ukrainian media outlet Ukrainska Pravda reported on November 25 that Russian forces control Pokrovsk, south of the Donetska Railway, which is consistent with Russian and Ukrainian reporting of the situation in the area south of the railway in recent days.[32] Ukrainska Pravda reported that the current frontline in Pokrovsk largely runs along the northern outskirts of the town. A senior officer of a Ukrainian brigade operating in the Pokrovsk direction told Ukrainian media outlet Hromadske on October 31 that Russian forces were operating in roughly 60 percent of Pokrovsk as of late October.[33] Ukrainska Pravda reported on November 25 that Ukrainian counterattacks in Rodynske (north of Pokrovsk) were initially successful, but that Russian forces later retook the settlement.[34] A Ukrainian deputy battalion commander operating in the Pokrovsk direction told Ukrainska Pravda that Russian forces have brought tanks and mortars into Pokrovsk since November 19 – indicating that Russian forces have been able to deploy heavy equipment into Pokrovsk despite Ukrainian interdiction efforts.[35]

Russian forces continue efforts to infiltrate Myrnohrad and sever tactical Ukrainian ground lines of communication (GLOCs) connecting Myrnohrad and Pokrovsk, consistent with the new Russian offensive template that seeks to interdict tactical GLOCs after an operational interdiction campaign. The Ukrainian 7th Rapid Reaction Corps of the Air Assault Forces assessed on November 25 that Russian forces will attempt to sever the GLOCs between Pokrovsk and Myrnohrad in the near future.[36] The corps reported that Ukrainian forces are reinforcing units within Myrnohrad to defend the southern outskirts of the town, where Russian forces are accumulating. A Ukrainian officer operating in Myrnohrad told Ukrainska Pravda that the Ukrainian GLOCs to Myrnohrad lie entirely within the contested ”gray zone” over which neither Ukrainian nor Russian forces exert firm control.[37] A Ukrainian servicemember operating in Myrnohrad told Hromadske on October 31 that Russian first-person view (FPV) drone operators were already within range to interdict Ukrainian GLOCs connecting Pokrovsk and Myrnohrad.[38] Geolocated footage published on November 25 shows Ukrainian servicemembers taking Russian prisoners of war (POWs) along Tsentralna Street in central Myrnohrad, indicating that Russian forces recently managed to infiltrate deep into central Myrnohrad but are not yet comfortably exercising control over this area.[39]

Russian forces are employing their new offensive template in the Kostyantynivka-Druzhkivka tactical area, setting conditions for a future dedicated effort to seize Kostyantynivka and threaten the Ukrainian Fortress Belt from the south. A Ukrainian drone platoon commander operating in the Kostyantynivka direction told Ukrainska Pravda on November 25 that Russian forces have been entering Kostyantynivka for over a month (since about mid-October 2025) and are regularly engaging Ukrainian forces with small arms.[40] The drone platoon commander reported that the Russian presence in Kostyantynivka is no longer restricted to small sabotage and reconnaissance groups. A Russian milblogger claimed on November 25 that fighting is ongoing on the eastern outskirts of Kostyantynivka.[41] Russian forces have been heavily striking Kostyantynivka and its environs in recent months, likely as part of an operational-level BAI campaign aimed at degrading Ukrainian logistics and defensive ability ahead of dedicated ground operations to seize the city and the rest of Ukraine's Fortress Belt.[42] Russian and Ukrainian sources recently indicated that Russian forces had deprioritized the seizure of Kostyantynivka to complete the seizure of Pokrovsk, but that the Russian military command would likely reprioritize the seizure of Kostyantynivka after taking Pokrovsk.[43] The Russian military command likely seeks to continue interdiction efforts and infiltration missions into Kostyantynivka to set conditions for a future dedicated effort to seize the city at a time of its choosing.

https://understandingwar.org/research/russia-ukraine/russian-offensive-campaign-assessment-november-25-2025/

22,443 posted on 11/26/2025 2:17:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22431 | View Replies]

Day 1,370 of the Muscovian invasion. 980 [average is 852] i.e. more than 40 Russians, Norks and Cubans/h. Vehicles and fuel tanks more than 145% and artillery more than 70% above average.
+743 UAVs is the highest daily loss of the war.


22,444 posted on 11/26/2025 4:26:17 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22442 | View Replies]

To: BeauBo; blitz128; gleeaikin
Кремлевская табакерка
25NOV202

The church is preparing to urgently send 600 priests to the front

According to our source close to Patriarch Kirill, these additional clergy “will solve several urgent problems at once.” In particular, they will increase the morale of the military at the front, “bury the dead soldiers on time, since priests who are in the NVO zone do not always have time to do this”, hold prayers before and after the assaults, and so on.

In addition, according to the channel's interlocutor, the priests will be given the most important task - “to preserve the purity of faith in the NVO zone and in the army as a whole.” They will fight against neo-pagans among the military (the Church has been working in this direction for a long time), identify and hand over to the competent authorities supporters of Satanism banned in Russia, make sure that Christians in the army “do not stray from the true path – swear less, do not drink alcohol, pray regularly, and so on.”

“The Church really wants the Victory of Russia. We all understand that there are still a few years of the NWO ahead. And we are simply obliged to additionally support the army in such a situation, strengthen it, make it cleaner and stronger,” said another source close to Patriarch Kirill.

https://t.me/kremlin_secrets/6463

It will probably be appreciated by the soldiers who will die for the little Tsar.

22,445 posted on 11/26/2025 4:39:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22389 | View Replies]

To: blitz128
And I am sure the Russians are just limited to X

When you can actually articulate who these Russians are, and what they do to adversely affect Americans, please come back and post your results. Until then take your double digit IQ and get to work. Those fries need frying.

22,446 posted on 11/26/2025 4:40:42 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22441 | View Replies]

To: JonPreston

22,447 posted on 11/26/2025 4:41:44 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22446 | View Replies]

To: JonPreston

22,448 posted on 11/26/2025 4:42:04 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22447 | View Replies]

Кремлевская табакерка
25NOV202

Putin thanked Belousov for the “particularly important” blow to Kyiv and instructed the minister to study the issue of mobilization

A source in the Ministry of Defense close to Andrei Belousov told us about this. “Vladimir Vladimirovich called and thanked Andrei Removich for the way we covered Kyiv with missiles and drones. I noted that this strike is especially important, it has not only military, but also international, a kind of diplomatic significance. After all, it never hurts to show the whole world the power of Russian weapons,” the channel's interlocutor said.

Vladimir Putin also asked Belousov what he thought about conducting a serious wave of mobilization, as a result of which the army would be replenished by 300-500 thousand people (Valery Gerasimov has constantly and long proposed to the president to carry out such a mobilization). The Minister of Defense did not give an unequivocal answer, and Vladimir Vladimirovich instructed him to study the issue. Putin wants to receive Belousov’s report on the topic of mobilization in ten days.

https://t.me/kremlin_secrets/6464

22,449 posted on 11/26/2025 4:42:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22445 | View Replies]

To: JonPreston

22,450 posted on 11/26/2025 4:42:24 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22448 | View Replies]

To: JonPreston

To: JonPreston

Do this again and I will push the abuse button.

22,284 posted on 11/20/2025 7:59:34 AM PST by dennisw (There is no limit to human stupidity / )

22,451 posted on 11/26/2025 4:43:07 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22450 | View Replies]

To: BeauBo; blitz128; GBA
Кремлевская табакерка
26NOV202

“The special military operation will not end for several more years, most of the goals have not been achieved.” The Central Bank is panicking

A high-ranking source in the Kremlin told us that the special military operation is likely to last for several more years. This is how he commented on rumors that hostilities may soon cease as a result of intensified negotiations on the Ukrainian crisis. “The special military operation, I think, will not end for several more years. So far, most of the goals of the special operation have not been achieved, even Donbass has not yet been liberated. And in the near future, probably, it will not be. Where should we stay? The army is fighting heroically. I am sure that almost no one there even thinks (except for individual soldiers, there are always such people) about stopping, demobilizing and so on. Vladimir Vladimirovich has no thoughts of stopping either. I hope it will not appear,” the channel's interlocutor believes.

The Central Bank does not agree with this position. A source close to Elvira Nabiullina notes that “the special military operation should be completed as soon as possible.” “Otherwise, there will be a terrible disaster in the economy next year. I don't want to say how scary it is,” the representative of the Central Bank said. And he assured that such panic forecasts have serious grounds.

At the same time, military forecasts are not given now. True, they do not agree that few people in the army think about demobilization and the completion of the NWO. These topics are becoming more and more popular there, many guys are tired. You need to talk about this honestly! We do not like such contradictions. Confusion in wartime is not very right. We hope everything will be fine.

https://t.me/kremlin_secrets/6466

Кремлевская табакерка
26NOV202

About the negotiations. Briefly, for now.

It is easy to notice that the situation around the negotiation process is changing every day. The publication of the conversation between Ushakov and Whitkoff in Bloomberg was unexpected for many. We will write about this later, but it is obvious that this leak can seriously affect the outcome of the negotiations.

What is important? The process is underway. Russian negotiators managed to convince the American side that the conquest of new territories, in particular the entire DPR, is a matter of time. According to the forecasts of our interlocutors, the liberation of Donbass may take more than a year, but even these deadlines may be shifted. Obviously, such an advance requires a lot of resources, equipment and personnel. It is difficult to talk about the results of the settlement in full now. Vladimir Putin, according to sources, is convinced of the possibility of achieving the goals of the NWO by military means and does not intend to make any concessions. This alarms representatives of the Central Bank, who directly talk about the accumulated problems in the economy.

Negotiations are underway not only about Ukraine, but about the security architecture in Europe as a whole. Russia needs guarantees of non-expansion of NATO to the east. At the same time, a number of influential people in the president's entourage insist that it is clearly unnecessary to give any guarantees to Ukraine. In any case, there is no need to record this on paper. “Ukraine will cease to exist in the foreseeable future. And in a conversation with the Americans, we must record that this territory remains under our control. Odesa, Kharkiv, Kyiv are our cities,” says a source in the president's inner circle.

The interlocutors also talk about the importance of cooperation with China and the United States for the growth of Russia's economic influence in the world.

https://t.me/kremlin_secrets/6467

22,452 posted on 11/26/2025 5:00:25 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22449 | View Replies]

To: marcusmaximus; FtrPilot

22,453 posted on 11/26/2025 5:00:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22451 | View Replies]

To: blitz128; BeauBo
Кремлевская табакерка
26NOV202

“More than one year.” The Kremlin officially confirmed that they do not plan to end the NWO in the near future

Dmitry Peskov urged not to draw premature conclusions about the proximity of the conflict in Ukraine to an end. These words are fully confirmed by our insiders. We have repeatedly written that the imminent completion of the NWO is not planned now. “I think Peskov has removed all questions. And then I'm tired of hearing a little about the fact that the special military operation will end soon. Have we achieved at least half of the goals? Or are you close to it? No! Therefore, let's fight and not tell nonsense!” said a source in the Kremlin. How long the NWO will last, he refused to predict. He only noted that “if nothing changes, then it is clearly more than one year.”

https://t.me/kremlin_secrets/6468

22,454 posted on 11/26/2025 5:04:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22452 | View Replies]

To: AdmSmith

EXCLUSIVE: US presidential envoy Steve Witkoff advised Russia on how to pitch Ukraine plans to Trump, in audio files reviewed by Bloomberg. From bloomberg.com

Here’s the story without the paywall:
https://archive.is/7GArV

During his call with Ushakov, Witkoff told his Russian counterpart that he had deep respect for Putin and that he had told Trump that it was his belief that Russia has always wanted a peace deal. The US envoy mentioned Zelenskiy’s upcoming visit and suggested that Putin could speak to Trump ahead of that meeting.

“Zelenskiy is coming to the White House on Friday,” Witkoff said. “I will go to that because they want me there, but I think if possible we have the call with your boss before that Friday meeting.”

Ushakov asked Witkoff whether it would be “useful” for Putin to call Trump. Witkoff said it would.

He also recommended that Putin congratulate Trump for the Gaza peace deal, say that Russia had supported it and that he respects the president as a man of peace. “From that, it’s going to be a really good call,” Witkoff said.

“Here’s what I think would be amazing,” Witkoff then added. “Maybe he says to President Trump: you know, Steve and Yuri discussed a very similar 20-point plan to peace and that could be something that we think might move the needle a little bit, we’re open to those sorts of things.”

Ushakov appeared to take some of the advice on board. Putin “will congratulate” and will say “Mr Trump is a real peace man,” he said.

Trump and Putin held their call two days later, at Russia’s request, and the US president described the two-and-a-half-hour-long conversation as “very productive.” Afterward, he announced plans to meet with the Russian leader in Budapest, a summit that is yet to take place, and also mentioned that Putin had congratulated him on the Gaza deal.

Following up on that call, Witkoff met with Kirill Dmitriev, another senior Kremlin adviser, in Miami, according to an interview that Dmitriev gave to Axios. Dmitriev told Axios he spent three days in Miami from Oct. 24.

A spokesperson for Dmitriev declined to comment.

Call Transcript between Ushakov and Dmitriev, plotting their scheme, here:
https://archive.is/adGNJ


22,455 posted on 11/26/2025 9:38:22 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22454 | View Replies]

WarTranslated@wartranslated
https://x.com/wartranslated/status/1993369910064357846

A Z-blogger spoke about the ineffectiveness of Russian electronic warfare systems on combat aircraft, which led to massive aviation losses. None of the electronic warfare and electronic countermeasure systems, which Russian military called "the best in the world," were able to reliably protect their planes in a real war.


22,456 posted on 11/26/2025 9:42:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22455 | View Replies]

To: AdmSmith; BeauBo; blitz128; PIF; MalPearce; marcusmaximus

Burying all those dead Russian soldiers has been a serious problems, compounded by the fact that their identity is not collected and soldiers who have tried to delivery identity information have been ordered NOT to COLLECT it. The goal seems to be saving money by reporting these soldiers as missing or deserted, and thus not having to pay death benefits to grieving family. What a great country to die for.

Perhaps these 600 priests may improve the information on deaths and thus payments to families. That would certainly improve morale in the hinterland from which most of these dead soldiers were recruited. The question is whether these Kirill/KGB assigned priests would actually be able to do this. They might be instructed to assure the troops that families will be informed. However, would commanders still be able/instructed to prevent forwarding of such information, even if these burial priests turned it in? Then again, these priests could perhaps be spies directly reporting to Kirill who apparently has direct access to Putin. Kirill could then bypass the lies Putin gets from frightened commanders who cannot accomplish the difficult/impossible demands. It is hard to conduct a war if you lack tanks, food, fuel, etc. to give your troops. So many lies about so many conditions, and consequences for failure can be so severe it is a wonder that anyone gets anything done. This is one reason commanders order some of their troops to kill others of their troops if they do not take suicidal risks to advance. Improving morale under these conditions will be almost impossible without a big assist from God, if he takes sides in such mass human insanity.


22,457 posted on 11/26/2025 10:57:55 AM PST by gleeaikin (Question Authority: report facts, and post their links in your message.)
[ Post Reply | Private Reply | To 22445 | View Replies]

To: gleeaikin; AdmSmith

“Perhaps these 600 priests”

... are really just FSB assets, sent to gain the confidence of soldiers, and collect intelligence on any potential rebellions that might be developing.


22,458 posted on 11/26/2025 11:23:56 AM PST by BeauBo
[ Post Reply | Private Reply | To 22457 | View Replies]

To: BeauBo

More treachery from Witkoff revealed -

“Putin convinced Trump not to send Ukraine Tomahawks in call set in motion by Witkoff, transcript shows”

“The critical Putin-Trump call came after Witkoff suggested to Yuri Ushakov, Russia’s top foreign policy aide, that Putin ingratiate himself with the US president by stroking his ego on achieving the Gaza cease-fire deal about a week before, according to a transcript published by Bloomberg of an Oct. 14 call between the US envoy and Kremlin chief foreign policy advisor.

A readout of the Oct. 16 call from Russia says Putin indeed congratulated Trump about his “successful efforts” in Gaza and said Trump’s “peace work has been duly appreciated ... around the world.”

Putin then told Trump that arming Ukraine with Tomahawks would “inflict substantial damage to relations between our countries, to say nothing of the prospects for a peaceful settlement,” according to Russia’s account of the call...

Witkoff then told Ushakov to ensure that Putin did not mention his intent to demand Ukraine give up land Russia has been unable to take in more than 11 years in the Donbas - which others in the Trump administration have dubbed a red-line “maximalist” demand - though he acknowledged that would be the long-term goal...

https://nypost.com/2025/11/26/world-news/putin-convinced-trump-not-to-send-ukraine-tomahawks-in-call-set-in-motion-by-witkoff/


22,459 posted on 11/26/2025 11:53:17 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22458 | View Replies]

National guard shot near WH


22,460 posted on 11/26/2025 12:03:00 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22459 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,421-22,44022,441-22,46022,461-22,48022,481-22,492 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson