Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 22,021-22,04022,041-22,06022,061-22,080 ... 22,361-22,362 next last
To: BeauBo
Day 1,358 of the Muscovian invasion. 1,040 [average is 851] i.e. more than 43 Russians, Norks and Cubans/h. Vehicles and fuel tanks more than 90% above average


22,041 posted on 11/15/2025 1:02:53 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21980 | View Replies]

To: PIF; BeauBo; blitz128; gleeaikin; Dot; adorno; Timber Rattler; dennisw
Russian Offensive Campaign Assessment, November 14, 2025

The Russian military command appears to be prioritizing the seizure of Pokrovsk over efforts to close the wider Ukrainian pocket in the Pokrovsk-Myrnohrad area. Russian advances in and around Pokrovsk over the last several days suggest that Russian forces in Pokrovsk are prioritizing the seizure of the settlement itself. They do not appear to be focused on supporting efforts by the 51st Combined Arms Army (CAA, formerly the 1st Donetsk People's Republic Army Corps [DNR AC], Southern Military District [SMD]) to close the pocket from the north and northeast with a complementary attack from the south at this time.[1] Russian forces may be prioritizing the seizure of Pokrovsk for a number of reasons. Russian leadership may seek to exploit the informational effects that the town's seizure will likely generate, or may hope that the seizure of Pokrovsk will facilitate a subsequent effort to close the pocket. Ukrainian counterattacks on the northern shoulder of the pocket and a continued Ukrainian presence within Pokrovsk are complicating Russian advances and Russia's ability to close the pocket, but that fact should not be enough in itself to cause the Russian command to be distracted from the effort from the south. The 51st CAA has also been struggling to advance from the northeast, moving more slowly than the 2nd CAA (Central Military District [CMD]) is moving within Pokrovsk and on the western flank of the pocket.[2] The 51st CAA’s slower tempo could also be contributing to Russia's apparent and possibly temporary prioritization of the seizure of Pokrovsk. The Russian military command is notably not pursuing the standard measures one would expect in such a battlefield configuration, namely focusing forces and means on completing the encirclement, which would normally be the fastest and least costly way to seize the entire area. The Russian military command can change its focus at any time, however.

Russian forces continue to advance within the pocket in the Pokrovsk direction. Geolocated footage published on November 13 and 14 indicates that Russian forces recently advanced in northern and eastern Pokrovsk and in southern Myrnohrad.[3] Additional geolocated footage published on November 14 indicates that Russian forces recently conducted infiltration operations in southeastern Pokrovsk.[4] Pokrovsk itself remains contested, however, and Ukrainian forces continue to hold positions within the settlement. Geolocated footage published on November 14 indicates that Ukrainian forces maintain positions or recently advanced in northern Pokrovsk, contrary to Russian claims of Russian advances.[5] Geolocated footage published on November 14 indicates that both Ukrainian and Russian forces hold positions in northern Pokrovsk.[6] Russian milbloggers acknowledged that Russian forces do not control all of the town and that there is fighting ongoing in northern and eastern Pokrovsk.[7]

Ukrainian forces continue efforts to prevent Russian advances on the northern shoulder of the pocket. Additional geolocated footage published on November 14 indicates that Russian forces seized Novotoretske and advanced in central Boikivka (both northeast of Pokrovsk).[8] Ukraine's Special Operations Forces (SSO) reported on November 14 that Ukrainian forces conducted a drone strike against a concentration of Russian servicemembers of the 1st Slovyansk Motorized Rifle Brigade and 9th Motorized Rifle Brigade (both of the 51st CAA) in Zatyshok (northeast of Pokrovsk), where they had recently accumulated in a building during adverse weather conditions.[9] The Ukrainian Eastern Group of Forces reported on November 14 that the Ukrainian Air Force struck a Russian transport communications facility and a concentration of Russian forces near Shevchenko (in the Russian near rear south of Pokrovsk) with a GBU-62 Joint Direct Attack Munition-Extended Range (JDAM-ER) guided bomb.[10] Russian milbloggers also claimed that Ukrainian forces continue to counterattack near Rodynske.[11]

Russia continues to rely on North Korea for manpower to offset Russia's labor and military personnel shortages. Ukraine's Main Military Intelligence Directorate (GUR) on November 14 reported Russian plans for roughly 12,000 North Korean workers to join the Alabuga Special Economic Zone (ASEZ) in the Republic of Tatarstan by the end of 2025 to work at Russia's factory producing Shahed-type drones.[12] The GUR reported that the Russian Ministry of Foreign Affairs (MFA) met with local government officials and representatives of the North Korean company Jihyang Technology Trade Company in October 2025 to discuss the details. The GUR stated that the Jihyang Company is responsible for the search and selection of North Korean workers to go to Russia, and the company is reportedly a front company for Green Pine, a US sanctioned company that is a hub for North Korea's weapons trade and has aided North Korea's nuclear program.[13] Japanese outlet NHK reported in June 2025 that North Korea was “considering” sending 25,000 workers to drone production facilities at the ASEZ, and the reported 12,000 North Koreans going to the drone factory by the end of the year are likely in addition to these 25,000.[14] The Russian Ministry of Defense (MoD) reported on November 14 that North Korean sappers are demining in Kursk Oblast alongside Russian sappers.[15] The Russian MoD noted that the North Korean sappers previously underwent training at Russian engineering troop training centers. South Korea's Yonhap News Agency reported in early November 2025 that North Korea deployed roughly 5,000 military engineering troops to Russia, that there were 10,000 North Korean troops near the Russian-Ukrainian border performing “security duties,” and that another 1,000 troops were clearing mines.[16] ISW continues to assess that the deployment of North Korean troops to support roles frees up Russian forces to deploy to the battlefield.[17] North Korean workers at the ASEZ will also notably be able to take lessons on large-scale drone production back to North Korea.

Ukrainian forces continue to enhance their air defense system against Russian strikes in ways that offer Europe and the United States valuable lessons. Ukrainian Defense Minister Denis Shmyhal announced on November 14 that Ukraine launched serial production in Ukraine of the “Octopus” interceptor drone with three manufacturers beginning immediately and 11 others preparing production lines.[18] Shmyhal noted that the interceptor drones are able to operate at night, in electronic warfare (EW) contested environments, and at low altitudes. Shmyhal reported that the Octopus can intercept Russian Shahed-type drones. Shmyhal’s announcement follows a similar announcement on October 20 about the production of the Octopus drones in the UK.[19] Business Insider reported on November 12 that European defense company Atreyd stated that it shipped its “drone wall” system to Ukraine.[20] The “drone wall” reportedly consists of a collection of first-person view (FPV) drones that launch from designated platforms if radar systems detect a threat, and the drones are arrayed in layers and spaced apart. The FPVs intercept Russian drones by detonating nearby. The system reportedly relies on artificial intelligence (AI) to operate autonomously, and one operator will be able to control 100 drones. Business Insider reported that the “drone wall” system is able to operate in GPS-denied areas as it uses pre-installed 3D maps of the area, augmenting the system's electronic warfare (EW) resilience. The system's drones are able to operate at various altitudes and are equipped with identification technology to prevent friendly fire. Business Insider noted that system operators will not require any specialized training nor prior drone pilot training. Atreyd noted that the system will likely be operational in Ukraine within a few weeks and that Ukraine will employ the system to defend its cities and critical infrastructure, but may deploy systems closer to the frontline to intercept Russian glide bombs later. Atreyd’s “drone wall” system is defensive in nature and notably differs from Ukraine's tactical ”wall of drones” concept, which uses a large number of tactical strike drones and loitering munitions to destroy manpower and equipment on the frontline.[21] Europe can glean important lessons from Ukraine's air defense measures, including its future employment of Atreyd’s system, to understand how innovations in tactics and technology can counter Russia's evolving aerial threats. ISW continues to assess that the West should support Ukraine's interceptor drone program not only for Ukraine's defense against Russian strikes but also for the defense of Europe.[22]

Russian forces conducted a series of drone and missile strikes against Ukraine on the night of November 13 and 14 that largely targeted Ukrainian civilian areas. The Ukrainian Air Force reported that Russian forces launched three Kh-47M2 Kinzhal aeroballistic missiles from Ryazan Oblast; one Zirkon anti-ship missile from an unspecified location; six Iskander-K/Kalibr cruise missiles from the waters near occupied Crimea and in the Black Sea; and nine Iskander-M/KN-23 ballistic missiles from Bryansk Oblast.[23] The Ukrainian Air Force reported that Russian forces also launched 430 Shahed-type, Gerbera-type, and other drones, including roughly 300 Shahed-type drones, from the directions of Kursk, Oryol, and Bryansk cities; Millerovo, Rostov Oblast; Primorsko-Akhtarsk, Krasnodar Krai; and occupied Hvardiiske, Crimea. The Ukrainian Air Force reported that Ukrainian forces downed two Kinzhal missiles, six Iskander-M/KN-23 ballistic missiles, all six Iskander-K/Kalibr cruise missiles, and 405 drones; that one missile and 23 drones struck 13 locations; and that drone debris fell at 44 locations. The Ukrainian Air Force reported that Russian forces concentrated their strikes on Kyiv City. Ukrainian President Volodymyr Zelensky reported that the Russian strikes mainly targeted Kyiv, Kharkiv, and Odesa oblasts, injuring dozens of civilians and killing at least four.[24] Zelensky highlighted how Ukraine's air defense systems, including US-made Patriot systems, neutralized 14 Russian missiles.[25] Kyiv Oblast Military Administration Head Timur Tkachenko reported that the Russian strikes injured 35 civilians and killed six in Kyiv Oblast.[26] A Russian Iskander missile damaged part of the Azerbaijani Embassy in Kyiv City.[27] Ukrainian officials reported that the Russian strikes damaged civilian and energy infrastructure in southern Odesa Oblast, killing two and injuring 11 at a market in Chornomorsk.[28] ISW continues to assess that Russia remains committed to leveraging its long-range strikes that target Ukraine's civilian populace in an effort to sow fear and demoralize the Ukrainian people.[29]

Infrastructure on the night of November 13 to 14. The Ukrainian General Staff reported that Ukrainian forces struck the Russian ship base in Novorossiysk, Krasnodar Krai with drones and Neptune missiles.[30] Ukrainian forces reportedly damaged port infrastructure, the Sheskharis oil terminal, and a launcher and missile storage area of an S-400 air defense system. The Sheskharis terminal is one of the largest oil tanker complexes for the transshipment of oil and petroleum products in southern Russia and supplies Russian forces operating in Ukraine. A source in Ukraine's Security Service (SBU) told Ukrainian outlet Suspilne that the Ukrainian strikes damaged oil tankers, pipeline infrastructure, and pumping units as well as an S-300/400 air defense system at the base of the Russian 1537th Anti-Aircraft Missile Regiment (7th Airborne [VDV] Division).[31] Geolocated footage published on November 13 and 14 shows an explosion at the base of the 1537th Anti-Aircraft Missile Regiment in Novorossiysk and a large fire near the Novorossiysk oil terminal.[32] The Krasnodar Krai Operational Headquarters claimed that Ukrainian drone strikes damaged the oil depot at the Sheskharis transshipment complex and that falling drone debris started a fire.[33] The headquarters claimed that Ukrainian forces struck a civilian vessel in the port of Novorossiysk.[34] Reuters reported on November 14 that industry sources stated that the Novorossiysk port halted exports and Transneft suspended crude supplies to the outlet following the Ukrainian strikes.[35]

The Ukrainian General Staff reported that Ukrainian forces also struck the Saratov Oil Refinery in Saratov Oblast, which supplies the Russian military.[36] The Ukrainian General Staff reported that Ukrainian forces also damaged infrastructure at the Krystal Plant fuel and lubricants storage enterprise in Engels Raion, Saratov Oblast. Ukrainian strikes reportedly caused fires at both enterprises in Saratov Oblast. Russian opposition outlet Astra reported that the fire at the oil refinery likely originated at the fuel storage tank.[37] Saratov Oblast Governor Roman Busargin claimed that a drone strike damaged civilian infrastructure in Saratov City.[38]

more + maps https://understandingwar.org/research/russia-ukraine/russian-offensive-campaign-assessment-november-14-2025/

22,042 posted on 11/15/2025 1:09:31 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22012 | View Replies]

Day 1,359 of the Muscovian invasion. 1,000 [average is 851] i.e. more than 41 Russians, Norks and Cubans/h. Vehicles and fuel tanks more than 80% above average


22,043 posted on 11/15/2025 1:12:30 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22041 | View Replies]

To: ansel12

I’ll leave the nonsense talk about “our allies” to you NATO warriors.


22,044 posted on 11/15/2025 1:19:53 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22039 | View Replies]

To: JonPreston

I don’t think you can control your immaturity enough for that, this childishness is your life.


22,045 posted on 11/15/2025 1:21:38 PM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 22044 | View Replies]

To: AdmSmith
"I never took a dime"


22,046 posted on 11/15/2025 1:21:56 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22043 | View Replies]


22,047 posted on 11/15/2025 1:26:19 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22046 | View Replies]

To: JonPreston

22,048 posted on 11/15/2025 1:27:00 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22047 | View Replies]

To: blitz128
🍈

😂😂😂😂

🤡


22,049 posted on 11/15/2025 1:27:46 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22048 | View Replies]

To: JonPreston
(Mc) 🍈

😂😂😂😂

🤡

🍈

😂😂😂😂

🤡

es

22,050 posted on 11/15/2025 1:28:11 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22049 | View Replies]

To: marcusmaximus
WHERE IS MARCUS?


22,051 posted on 11/15/2025 1:29:17 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22050 | View Replies]

To: ansel12

He can’t be much over 12


22,052 posted on 11/15/2025 1:55:23 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22045 | View Replies]

To: AdmSmith

Good numbers


22,053 posted on 11/15/2025 2:39:57 PM PST by blitz128
[ Post Reply | Private Reply | To 22043 | View Replies]

To: AdmSmith

What Russian AD DOINK😂


22,054 posted on 11/15/2025 2:40:45 PM PST by blitz128
[ Post Reply | Private Reply | To 22042 | View Replies]

To: BeauBo

War is expensive and Russia is losing its money train

Soldiers are real sensitive about pay and food

Since Russia is buying its military things are going to get real interesting

Midget gargoyle czar better stay in his bunker


22,055 posted on 11/15/2025 2:53:24 PM PST by blitz128
[ Post Reply | Private Reply | To 22031 | View Replies]

To: dennisw

“...so Russia may have good solid defenses for it.” (Novorossisyk)

They tried.

Russia’s top of the line S-400 Air Defense System around Novorossisyk was part of their losses.

Lots of hits, and big explosions there.


22,056 posted on 11/15/2025 3:29:56 PM PST by BeauBo
[ Post Reply | Private Reply | To 22032 | View Replies]

To: BeauBo

“Russia’s top of the line S-400 Air Defense System around Novorossisyk was part of their losses.”

Doom on them. Ukraine is going have a tough winter with Russia hitting their power stations. Having to tough it out as Ukraine demolishes Russian oil and electrics. Ukraine has to make a mega strike on Moscow that will make it lights out for a few days. So that the Russia’s upper crust can see what Putin’s war has brought them.


22,057 posted on 11/15/2025 3:43:26 PM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22056 | View Replies]

To: BeauBo

Youtube>>>> Ukraine Destroyed Russia’s Port City on Black Sea
Jake Broe
________

some of transcript>>>>

And this is the most sensitive,
5:00
delicate, important part of the oil
5:02
export terminal. I’m guessing there’s
5:05
probably a little bit of refining going
5:06
on here as well. And it took two days,
5:09
but these are the earliest satellite
5:11
images. This is the before and this is
5:14
the after.
5:16
A direct hit. A massive explosion.
5:19
This oil terminal is fubard (FUBAR). It’s not
5:23
coming back anytime soon. I’ve just been
5:25
clicking around trying to find general
5:28
estimates. How long will this oil
5:31
terminal be offline? Best case scenario,
5:34
this is Russia’s number one priority.
5:36
They have their best people trying to
5:38
fix it. Two to three months.
5:42
Two to three months of downtime.
5:45
Concerning the air defense systems, this
5:47
is the satellite images. This is
5:49
November 11th. This is November 15th.
5:52
So, as of this morning, and yes, there
5:55
were definitely four S400 launchers<<<<<
5:58
located here. And they were all<<<<<<<
6:00
destroyed.<<<<<<<


22,058 posted on 11/15/2025 3:50:14 PM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22056 | View Replies]

To: dennisw

He says out for 3-4 months

22,059 posted on 11/15/2025 3:57:55 PM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22058 | View Replies]

To: JonPreston
WHERE IS MARCUS?

2001-Space-Odyssey-02
22,060 posted on 11/15/2025 4:17:45 PM PST by Right_Wing_Madman
[ Post Reply | Private Reply | To 22051 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,021-22,04022,041-22,06022,061-22,080 ... 22,361-22,362 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson