Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 17,381-17,40017,401-17,42017,421-17,440 ... 19,481-19,499 next last
To: JonPreston
šŸˆ


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ā˜®ļø )

17,401 posted on 06/16/2025 6:06:08 PM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 17400 | View Replies]

To: FtrPilot

17,402 posted on 06/16/2025 6:07:00 PM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 17400 | View Replies]

To: SpeedyInTexas

Chinese home prices have been declining, month after month, for years now. That has been the main investment vehicle of the Chinese middle class.

Real Estate is 25% of Chinese GDP, and everybody involved is losing money.

The massive overbuilding/oversupply is perhaps unprecedented in history - more than one empty, for every one occupied. That overhang is going to be a drag for a long time, and the bad loans are a huge bill to be paid.


17,403 posted on 06/16/2025 6:25:31 PM PDT by BeauBo
[ Post Reply | Private Reply | To 17394 | View Replies]

To: JonPreston

The era of RuZZia (USSR) as a superpower is over.


17,404 posted on 06/16/2025 6:29:56 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 17395 | View Replies]

To: SpeedyInTexas
Pray for Peace


17,405 posted on 06/16/2025 6:56:58 PM PDT by JonPreston ( ✌ ā˜®ļø )
[ Post Reply | Private Reply | To 17404 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, June 16, 2025

Ukraine's Foreign Intelligence Service (SZRU) reported that the Kremlin is spreading narratives about the POW and KIA exchanges in order to sow panic in Ukraine and discredit Ukraine in the international community – in line with ISW’s recent assessments. The SZRU reported on June 16 that Russian President Vladimir Putin personally decided to launch an information campaign depicting Ukraine as spoiling the POW exchanges and KIA repatriations in order to provoke discontent and demoralize Ukrainian society and to discredit Ukraine in the international community.[8] The SZRU reported that the campaign leverages pro-Kremlin sources, including Russian milbloggers, and pro-Russian media sources in Europe to project emotionally charged content, manipulate statistical data, and portray delays in exchanges and repatriations as the deliberate actions of the Ukrainian authorities. The SZRU reported that the campaign will culminate in the final days of the POW exchanges, which are set for June 20. ISW assessed in early June 2025 that the Kremlin was baselessly accusing Ukraine of failing to conduct POW exchanges and KIA repatriations and was promoting narratives that vilify Ukraine in order to socialize Russian domestic audiences ahead of Russia's possible rejection of any peace agreement in the future and to discredit Ukraine on the international stage.[9] Russia has previously launched similar discreditation campaigns against Ukraine that aimed to destabilize Ukraine internally, such as the ā€œMaidan-3ā€ information operation, which Ukrainian intelligence reported in early 2024 sought to sow panic and discontent among Ukrainians and drive a wedge between Ukrainian society and military and political leadership.[10]

Russia's consumption of its Soviet-era tank stores appears to be slowing, possibly due to Russia's increasing transition to using motorcycles and all-terrain vehicles (ATVs) on the battlefield. A social media source tracking equipment at Russian military depots via satellite imagery shared an updated assessment of smaller Russian tank and armored vehicle storage facilities on June 15 and assessed that Russia still has 46 percent of its pre-war tank reserves, 42 percent of its pre-war infantry fighting vehicle (IFV) reserves, and 48 percent of its pre-war armored personnel carrier (APC) reserves as of a recent unspecified date.[11] The source stated that imagery of eight Russian military depots appears to show that Russia has emptied most of the depots of their vehicle reserves and assessed that Russia will likely deplete its remaining tank and armored vehicle reserves by the end of 2025.[12] The social media source assessed in late December 2024 that Russia had 47 percent of its pre-war tank reserves, 52 percent of its pre-war IFV reserves, and 45 percent of its pre-war APC reserves remaining in storage.[13] (The source noted on June 15 that they updated their previous assessments of Russia's pre-war reserves and found that Russia had 241 more tanks, 174 more IFVs, and 687 more APCs before the full-scale invasion than the source previously assessed, which likely accounts for the increase in Russian APCs stores from 45 percent in the December 2024 assessment to 48 percent in June 2024.[14]) The social media source also stated that satellite imagery analysis indicates a ā€dramaticā€ increase in ā€almost allā€ types of equipment deployed to a Russian military base near Petrozavodsk, Republic of Karelia, located roughly 373 kilometers from the international border with Finland.[15] Russia may have additional armored vehicles and tanks in covered storage that are not visible in satellite imagery. The Wall Street Journal (WSJ) reported on April 27 that a senior Finnish military official stated that Russia is sending ā€œalmost noneā€ of its newly produced tanks to the frontline in Ukraine but is stockpiling the.ā€[16]

The social media source's data suggests that Russia's consumption of Soviet-era tank stocks has slowed in recent months, an observation consistent with ISW’s study of recent battlefield combat footage which shows that Russian forces are increasingly using motorcycles and buggies in place of armored vehicles along the frontline in Ukraine. Russian forces have been increasingly using unarmored civilian vehicles, mainly motorcycles and all-terrain vehicles (ATVs), throughout the theater in Ukraine since late Fall 2024.[17] ISW previously noted that Russia's increased use of motorcycles is an adaptation in response to pervasive Ukrainian drone strikes against Russian armored vehicles and the unsustainable armored vehicle losses that Russian forces suffered in late 2023 and 2024.[18] Ukrainian drone operations have significantly complicated how to tactically employ tanks, as large and slow-moving armored vehicles and tanks are vulnerable to drones. Russian forces appear to be leveraging faster-moving motorcycles and buggies to advance through the contested ā€œgray zonesā€ that Ukrainian and Russian drone operators have created along the frontline. Russia's adaption has succeeded in granting Russian forces marginal tactical gains at the expense of significant infantry losses.[19] ISW previously assessed that Russian armored vehicle losses are unsustainable and are undermining Russia's ability to sustain a protracted high-intensity war, but it remains unclear if Russia's increased reliance on motorcycles and buggies will be sufficient to offset these losses in the medium- to long-term.[20]

Russia continues to set conditions to pose a long-term strategic threat to the United States and its Western allies even after the end to Russia's war in Ukraine. Swedish news outlet SVT reported on June 16 that Planet Labs satellite imagery collected in May 2025 shows that Russia is developing and upgrading at least five nuclear facilities in western Russia and Belarus.[21] The satellite images show recently constructed test sites, fencing, loading quays, and storage and communications infrastructure at Russian nuclear bases in Kaliningrad Oblast and Novaya Zemlya, Arkhangelsk Oblast as well as at the Gadzhiyevo Submarine Base and a supporting facility at Olenya Bay, Murmansk Oblast. The satellite imagery also shows upgrades to fencing and railway infrastructure at a military base in Asipovichy, Belarus.[22] Swedish Defense Minister PƄl Jonson told SVT that Swedish defense services have been tracking these construction efforts, which indicate continued Russian investment in its nuclear capabilities.[23] ISW observed reports in March 2025 that satellite imagery showed that construction work on hangars for Iskander ballistic missiles in Asipovichy was in its final stage, and the New York Times reported in May 2024 that satellite imagery indicated that Belarus had been constructing facilities that could house nuclear warheads at a base 12 kilometers away from the Iskander storage site in Asipovichy.[24]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-june-16-2025

17,406 posted on 06/16/2025 10:43:25 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17334 | View Replies]

To: BeauBo; FtrPilot; PIF; blitz128

🤣Russians train to storm the right bank of the Dnipro

https://bsky.app/profile/militarynewsua.bsky.social/post/3lroayrbzrk2m

1 min video

Are they drunk?


17,407 posted on 06/16/2025 11:05:42 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17406 | View Replies]

To: gleeaikin
The return of the bodies of the dead is one of the most difficult, but extremely necessary missions.

After each repatriation, painstaking work begins: an autopsy, a thorough examination by investigators, conducting DNA examinations, checking every detail. This process is already complex and lengthy. And Russia is also deliberately complicating the identification process for us. The bodies are returned in an extremely mutilated state, body parts in different bags. There are cases when the remains of one person are returned even during different stages of repatriation.

In addition, during the last repatriations, the bodies of Russian soldiers were also transferred to us - mixed with the bodies of Ukrainians. Unfortunately, this is a fact. This could have been done intentionally by the Russians in order to increase the number of transferred bodies and burden our experts with work, complementing all this with cynical information pressure. Or it could be their usual negligent attitude towards their own people. In any case, we also identify these bodies.

Our experts are working at the limit of the possible. Each examination is carried out carefully and more than once. Specialists are trained, laboratories are equipped, processes are worked out. The biggest challenge is time. We understand the pain and expectations of families. We accelerate the identification process as much as possible. But with each large repatriation, it becomes more difficult to do this, and perhaps this is precisely Russia's goal.

We have no right to make mistakes. For us, these are not statistics. These are people, and each of them deserves to be treated with dignity.

https://t.me/Klymenko_MVS/1502

17,408 posted on 06/16/2025 11:17:22 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17407 | View Replies]

To: SpeedyInTexas
ā—ļøšŸ‡®šŸ‡± šŸ‡®šŸ‡· Israel has eliminated new commander-in-chief after three days in office.

https://x.com/Maks_NAFO_FELLA/status/1934901515246030920


17,409 posted on 06/17/2025 5:33:15 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 17404 | View Replies]

To: BeauBo

17,410 posted on 06/17/2025 6:08:45 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 17409 | View Replies]

To: blitz128
ā—ļøThe Israeli Air Force again launches powerful airstrikes on the Iranian capital Tehran

The Shahr Rey oil refinery was reportedly hit again.

https://x.com/front_ukrainian/status/1934951276279980433


17,411 posted on 06/17/2025 6:19:34 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 17410 | View Replies]

To: BeauBo; AdmSmith; ETCM
The IAEA says that it has detected direct bomb impacts on the underground nuclear enrichment halls at Iran’s Natanz nuclear facility.

The Israeli Air Force has repeatedly struck the facility, one of the Iranian nuclear program’s prime targets.

https://x.com/Osinttechnical/status/1934950040726024583

...direct bomb impacts on the underground nuclear enrichment halls at Iran’s Natanz nuclear facility.

Worth repeating.

17,412 posted on 06/17/2025 6:23:46 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 17411 | View Replies]

To: PIF
ā—ļøMeanwhile, in the šŸ‡·šŸ‡ŗ Bryansk region, in the Kletnyansky district, a column of smoke is visible after a very loud explosion.

The region is being attacked by UAVs.

https://x.com/front_ukrainian/status/1934918392382713965


17,413 posted on 06/17/2025 6:28:20 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 17412 | View Replies]

To: SpeedyInTexas
THE END? Multiple sources are reporting a number of US air tankers and strike aircraft are airborne over Europe and the Mediterranean. Iranian ā€˜peace feelers’ are being ignored. The total defeat and surrender of Iran’s thug regime may be at hand. //DEVELOPING//

https://x.com/ChuckPfarrer/status/1934957962310623638


17,414 posted on 06/17/2025 6:31:55 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 17413 | View Replies]

To: blitz128
In the area under responsibility of the 3rd Brigade of Operational Assignment "Spartan" in the Pokrovsk direction, Russians attempted to break through by foot, motorcycles, and even electric scooters.

https://x.com/NOELreports/status/1934853214253224155


17,415 posted on 06/17/2025 6:35:42 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 17414 | View Replies]

To: AdmSmith; BeauBo; FtrPilot

Once the Ukraine autopsy team has DNA, and probably can determine if these dead are from Siberia tribal areas, how is this information being conveyed to Russian families or local informing sources, if such exist? Would something like the Voice of America, if such still exists, be able to say things like,”In the latest exchange of prisoners and combat remains, we have identified 2 members of one ethnic group (by name) and 5 of another group (also by tribal name).” Possible contact info could be transmitted?


17,416 posted on 06/17/2025 7:56:07 AM PDT by gleeaikin (Question Authority: report facts, and post theihr links')
[ Post Reply | Private Reply | To 17408 | View Replies]

To: FtrPilot

ā€œTHE END? Multiple sources are reporting a number of US air tankers and strike aircraft are airborneā€

Sunset in Tehran occurs about noon on the US East Coast.

Still time to get snacks and drinks ready.


17,417 posted on 06/17/2025 7:57:17 AM PDT by BeauBo
[ Post Reply | Private Reply | To 17414 | View Replies]

To: FtrPilot
Day 1,209 of the Muscovian invasion. 1,060 [average is 832/day], i.e. more than 44 Russians and Norks/h. Vehicles and fuel tanks more than 80%. Motorcycles are not counted yet.


17,418 posted on 06/17/2025 8:08:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17336 | View Replies]

To: gleeaikin
how is this information being conveyed to Russian families or local informing sources,

They probably don't have DNA to identify them.
17,419 posted on 06/17/2025 8:10:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17416 | View Replies]

To: FtrPilot

ā€œdirect bomb impacts on the underground nuclear enrichment halls at Iran’s Natanz nuclear facility.ā€

Likely a radioactive mess in there. Bury it in concrete.

I wonder if they had shutdown procedures that would minimize contamination if bombed, or if it was left to the will of Allah?


17,420 posted on 06/17/2025 8:11:16 AM PDT by BeauBo
[ Post Reply | Private Reply | To 17412 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 17,381-17,40017,401-17,42017,421-17,440 ... 19,481-19,499 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson