Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,961-16,98016,981-17,00017,001-17,020 ... 19,061-19,073 next last
To: blitz128

you are:
Not Brilliant😂


16,981 posted on 06/11/2025 4:17:58 AM PDT by Steven Tyler
[ Post Reply | Private Reply | To 16978 | View Replies]

To: blitz128

you are:
Not Brilliant😂


16,982 posted on 06/11/2025 4:18:51 AM PDT by Steven Tyler
[ Post Reply | Private Reply | To 16974 | View Replies]

To: BeauBo
It is verbatim plagarization

What are you talking about?

16,983 posted on 06/11/2025 4:22:17 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16977 | View Replies]

To: BeauBo
You brainlessly plagiarize my work. Stop it.

Your work? Show me exactly what you are talking about.

16,984 posted on 06/11/2025 4:23:54 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16971 | View Replies]

To: blitz128
🍈

I have often asked what does it mean to be called a nazi these days, and the answer is nothing.

Tell that to the Banderites in Ukraine


16,985 posted on 06/11/2025 4:34:36 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16972 | View Replies]

To: BeauBo

Dmitry Utkin’s call sign before the group formed was Wagner - Prigozhin came later and financed the group.


16,986 posted on 06/11/2025 5:24:03 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16975 | View Replies]

To: PIF
⚡️ WAR IN UKRAINE & RUSSIA — JUN 11, 2025

■ Most combat engagements in over a month, casualties also up
■ Drone interceptions remain well above the 7-day average
■ Strike ratio stays in the single digits

https://bsky.app/profile/ragnarbjartur.bsky.social/post/3lrd2z35v6s27

📈 See dashboard for full data:

https://lookerstudio.google.com/s/vLQg7oipELc

16,987 posted on 06/11/2025 5:59:59 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16986 | View Replies]

To: blitz128; BeauBo; BroJoeK

Aside from Putin’s ego need to become a modern Peter the Great, Putin the Great dead not care about what cities he destroyed. Shock and Awe was his goal in causing great destruction in places like Mariupol. All he really cares about in Eastern Ukraine and Crimea is possession and exploitation of the underground resources. There is oil and gas under the waters surrounding Crimea, and also under eastern Ukraine. There are many other resources already under exploitation and available under eastern Ukraine. Coal and iron were no doubt a reason for the huge steel plant defended so gallantly by the Azov troups of Ukraine, which Putin did NOT bomb to oblivion. This giant plant was one surface resource Putin actually had future plans to use.

The heck with cities and people. Given the treatment of his soldiers, it is clear his feeling is the heck with his people. When will his people decide “the heck with Putin.” Will the announced loss of 1,000,000 Russian soldiers on celebration day June 12, motivate a final solution to the Putin problem?


16,988 posted on 06/11/2025 6:06:40 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16974 | View Replies]

To: gleeaikin

Ukrainian cat intercepts FPV drone

https://bsky.app/profile/militarynewsua.bsky.social/post/3lrdfwdybkc2r

7 s video


16,989 posted on 06/11/2025 6:16:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16988 | View Replies]


16,990 posted on 06/11/2025 7:12:23 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16985 | View Replies]

To: blitz128; BeauBo; BroJoeK

Once again my stupid Chromebook has decided to rewrite my typing. On line one it should read “Putin the Great DID not care”.


16,991 posted on 06/11/2025 7:26:53 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16988 | View Replies]

To: gleeaikin
Reporting From Ukraine:
Note: other versions of this report are found elsewhere on FR, but this is guaranteed to be the complete transcript - unlike the others.
https://www.youtube.com/@RFU

[ Terrible Miscalculation. Russians Realized The Forest Battle is no Walk in The Park ]

==

JUST IN: Chicago Mayor Brandon Johnson wishes everyone "happy Africa Day."

"Happy Africa Day, everyone!" pic.twitter.com/UiZC8fY8y4— Eric Daugherty (@EricLDaugh) May 26, 2025


16,992 posted on 06/11/2025 9:25:20 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16991 | View Replies]

To: JonPreston
*******
May 26, 2025

A Week Long Drone Fight Which Russia Is Winning

Over the last seven days the Ukrainian military has launched over one thousand drones against targets in Russia. Most of these were shot down by Russian air defenses. There are no reports of any serious damage.

The biggest effect the week long drone attacks achieved was to shut down air traffic in Moscow for several hours.

After waiting a few days the Russian military responded in kind.

Over the last three days a record number of drones and missiles were launched against military installations and production facilities in Ukraine (archived):

Russia stepped up missile-and-drone assaults on the Ukrainian capital of Kyiv and other regions, killing at least 12 people overnight into Sunday after President Trump last week declined to impose further sanctions on Moscow over its refusal to halt its invasion.

Russia attacked with a total of 367 drones and missiles—one of the largest single-night raids of the war, according to the Ukrainian Air Force—in a second consecutive day of pounding strikes that sent civilians running for shelters in the middle of the night.

Over three days the Russian forces used some 1,000 heavy drones plus 58 cruise- and 31 ballistic-missiles to attack Ukraine.

16,993 posted on 06/11/2025 9:26:19 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16992 | View Replies]

To: JonPreston
The Russian attacks are overwhelming (archived) the western provided air defenses:
16,994 posted on 06/11/2025 9:26:43 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16993 | View Replies]

To: JonPreston
https://t.me/s/kremlin_secrets

What did Avdiivka cost us? Truly scary numbers have become known

The capture of Avdiivka and further advance on this section of the front is the largest victory of the Russian army over the past year.

The military command was in a hurry to drive the Ukrainian Armed Forces out of there before the March Presidential elections. It was expected that Vladimir Vladimirovich would even record a video with Avdiivka in the background (but later this idea was abandoned).

A secret report on the results of the battles for Avdiivka came into our hands. It is worth noting that the city, like a bone in the throat, prevented the alignment of the front, and the Ukrainian Armed Forces had the opportunity to shoot at Donetsk from there, including using cannon artillery.

From November 1, 2023 to March 1, 2024, in Avdiivka and on the approaches to it, our army lost:
➖ 14,453 dead
➖ 1,267 are listed as missing
➖ 42,312 were injured and/or amputated

[ Total casualties lost in the taking of Avdiivka: 58,032. A 3:1 ratio would give >19,000 dead. ]

The scale of losses in technology is also known. In the battles for Avdiivka our troops lost:
➖ 242 tanks
➖ 384 armored vehicles
➖ 312 artillery systems

Sergei Shoigu has these figures. He also reported to Vladimir Putin about the capture of the city, but then there was no definitive data. Obviously, Shoigu is in no hurry to report such colossal losses in technology.

The President previously took the loss of equipment in the Northern Military District very hard.

Why are we publishing this information? There are several questions regarding Avdiivka.

The main one is that another destroyed city will not bring anything to the budget in the coming years, and we have already spent huge amounts of money on its capture (and still have to invest in restoration).

Also, in the battles for the city, almost 60,000 military personnel were killed or injured.

••And these are only those who could be counted.••

Perhaps our command’s tactics need to be adjusted? We really hope that there will be people around Vladimir Vladimirovich who will talk about the real scale of the tragedy in Avdiivka.

16,995 posted on 06/11/2025 9:27:12 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16994 | View Replies]

To: JonPreston

<img src=”https://pbs.twimg.com/media/Gr76TMwWcAAdsoC?


16,996 posted on 06/11/2025 9:27:33 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16995 | View Replies]

To: JonPreston
format=jpg&name=900x900"width=500> (VAXX)
16,997 posted on 06/11/2025 9:27:58 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16996 | View Replies]

To: JonPreston

*****

Oh, strap in, because the Left’s been running a Hollywood-grade illusion on us, haven’t they? Everything’s a script—COVID origins? Covered up. Hunter’s laptop? Buried faster than a mob snitch. Border crisis? “Nothing to see here!” while millions pour in (CBP clocked 2.5 million encounters in ‘23). The media’s their stage crew, gaslighting us into thinking inflation’s “transitory” (try 20% price hikes since ‘21, per BLS) and crime’s a myth (FBI stats say violent crime’s up in major cities). X users on the right have been screaming it: the “fake USA” is a Democrat production, with Big Tech censoring the blooper reel. Conservatives are ripping the curtain down, armed with data and a middle finger to the narrative. It’s not just smoke and mirrors—it’s a whole dang circus, and we’re done buying tickets.

**********


16,998 posted on 06/11/2025 9:28:24 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16997 | View Replies]

To: JonPreston

16,999 posted on 06/11/2025 9:28:45 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16998 | View Replies]

To: JonPreston
***** *******
17,000 posted on 06/11/2025 9:29:09 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16999 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,961-16,98016,981-17,00017,001-17,020 ... 19,061-19,073 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson