Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,881-15,90015,901-15,92015,921-15,940 ... 21,481-21,489 next last
To: blitz128
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

15,901 posted on 05/18/2025 6:45:53 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15900 | View Replies]

To: blitz128

Saw the Stash on TV last night saying his analysis of the 47-Putin call is: 47 just wants to be in the spotlight [ and set himself up for the Noble Peace Prize ] while Putin believes he has and is successfully manipulating 47.

Just reporting.


15,902 posted on 05/18/2025 9:30:01 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15893 | View Replies]

To: PIF
Saw the Stash on TV last night....47 just wants to be in the spotlight

I'm glad you and the McDonalds manager knows who Stash is, because no one outside of your #NeverTrump circle has heard of him.

15,903 posted on 05/18/2025 10:01:27 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15902 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russian Jets Chased NATO Navy in the NATO Territory! ]

Today [ May 18, 8 pm ], there are interesting updates from the Baltic Sea ... European forces decided to act swiftly, following the newest EU sanctions package and detain an oil tanker from the Russian shadow fleet. In response to a planned boarding, Russian forces rapidly escalated the tensions by deploying their fighter jets to threaten the NATO ships from getting close.

A new wave of EU sanctions has directly targeted Russia’s notorious shadow fleet of oil tankers, which is used to bypass Western embargoes. As part of the EU’s 17th sanctions package, 149 vessels have been added to the blacklist for transporting Russian oil in violation of the price cap.

These mostly uninsured tankers will be barred from accessing EU ports and services, including insurance, repairs, and refueling. Among them, 25 were recently tracked in the Baltic and North Sea, where their presence also raises serious environmental and security concerns because of their poor condition.

European officials warn that these ships pose not only a pollution risk, but also a threat to vital undersea cables and energy infrastructure, due to several incidents with torn cables in the past.

Noting the Baltic Sea’s vulnerability to environmental disasters caused by oil spillage, due to its shallow and enclosed nature, the EU has prompted stricter sanctions on the aged and reckless ships of Russia’s shadow fleet.

As the EU prepares to expand the sanctions list to over 350 ships in total, it has also moved to authorize visa bans and asset freezes against shadow fleet captains. These measures aim to disrupt Russia’s illicit export routes and limit its wartime income.

Enforcement of the new package began immediately. A Gabon-flagged tanker under the name Jaguar, one of the newly sanctioned vessels, had previously anchored off a Russian port, prompting increased monitoring by NATO forces.

After approaching, the ship refused to identify itself and ignored orders from Estonia’s navy to halt and change course. Estonian patrol ships, helicopters, and patrol aircraft responded, with footage confirming the NATO response.

However, as NATO vessels prepared to board the Jaguar for inspection, the Russian Air Force dispatched a Su-35 fighter jet to the ship’s position in a show of force. According to Estonian defense officials, the Russian jet circled the tanker and signaled a clear intention to prevent any potential boarding or seizure.

Immediately, the planned boarding operation was called, as NATO captains and commanders assessed the risk of triggering a direct military clash as too high. An engagement involving NATO fighter jets or naval assets could have resulted in severe and far-reaching consequences. Estonia’s Foreign Minister confirmed that the aircraft briefly violated NATO airspace.

Finland and Lithuania both raised concerns about reckless Russian behavior, with Lithuania’s Prime Minister warning that Russia is clearly demonstrating a willingness to protect the route for its oil with all means, even risking a direct confrontation to protect its shadow oil fleet.

With conventional trade routes restricted due to Western sanctions, Russia relies heavily on this fleet of over 600 aging oil tankers to export crude oil to buyers from Asia.

These ships operate under obscure flags, are often uninsured, and are designed to operate below regulatory radar, making them critical to sustaining Russian state revenue, directly funding the war in Ukraine. Disruption of these flows would not only cripple Russia’s wartime economy, but also erode its global influence.

This incident shows how far Russia is willing to go to defend its economic lifelines, even deploying air assets to intimidate NATO ships. Yet, the imbalance in firepower is obvious. NATO F-35 squadrons routinely patrol the Baltic Sea. In a real engagement, a lone Russian fighter jet would have stood little chance. But, recognizing the risks, NATO wisely de-escalated to avoid a direct military engagement between Russia and NATO forces.

Overall, this standoff underscores the EU’s resolve to implement sanctions, which will only intensify. At the same time, Russia is desperate to protect its oil trade and take even higher risks.

With additional shadow fleet vessels likely to be sanctioned and better-armed naval patrols preparing future interception missions, Russia’s strategy of hiding its oil trade in plain sight is becoming increasingly untenable. The Jaguar may have escaped for now, but the message from Europe is clear: sanctions will not go unenforced.

https://www.youtube.com/watch?v=uWJvyIH5nFw


15,904 posted on 05/18/2025 12:11:37 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15891 | View Replies]

To: PIF

Romania remains on the side of the West, Freedom and Righteousness.

Kyiv Independent:

“Pro-EU candidate Nicusor Dan won the Romanian presidential election on May 18, defeating the far-right, anti-Ukraine George Simion.

With over 95% of the votes counted, Dan won Sunday’s runoff by a margin of 54.3% to Simion’s 45.7%, according to Romania’s election authority.

The result comes as a relief for Ukraine, who faced the loss of a key ally in the event of a Simion victory. Simion, leader of the Alliance for the Union of Romanians (AUR), championed a Euroskeptic platform that included ending military aid for Ukraine.

“Ukraine needs us, we don’t need Ukraine,” Simion said during a televised debate on May 8.

Simion is banned from entering both Ukraine and neighboring Molodova due to his anti-Ukrainian stance.

Dan, an independent centrist and the current mayor of Bucharest, supports aid to Ukraine, calling it “essential for the security of Romania.””


15,905 posted on 05/18/2025 1:25:15 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15904 | View Replies]

To: FtrPilot

Kyiv Independent:

“Russia carried out its largest single drone attack since the start of its full-scale invasion, launching 273 drones overnight on May 18, Ukraine’s Air Force reported.

The attack comes just two days after Ukraine and Russia held their first direct peace talks since 2022, and one day ahead of a planned call between U.S. President Donald Trump and Russian President Vladimir Putin.”

Send more Artillery! (Time for the big guns)

Drop the bone-crushing sanctions bomb. Time to get the job done.

Putin won’t stop, he must be stopped.

President Trump has given him every chance to get out of his mess the easy way, but Putin has clearly chosen to go down with the ship (and take down his country with him).


15,906 posted on 05/18/2025 1:36:23 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15905 | View Replies]

To: BeauBo; blitz128
Day 1,179 of the Muscovian invasion. 1,130 [average is 825/day], i.e. more than 47 Russians and Norks/h. Vehicles and fuel tanks more than 115% and artillery more than 60% above average. Motorcycles are not counted yet.


15,907 posted on 05/18/2025 2:03:03 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15839 | View Replies]

To: gleeaikin; PIF
Rosstat has classified detailed data on birth rates, death rates, marriages, divorces and corresponding coefficients in Russia.Instead of 6 files, 1 file is now published.
Regional data is completely classified! Monthly data has also been closed! (screenshot - all that remains!

In March, the birth rate fell by 5.6% y-o-y to a new historical minimum - 3012 people per day. And the death rate jumped by 5.8% y-o-y to 5078 people per day. As a result, the natural decline increased by 28.4% y-o-y (!!!) to 2066 people per day. Rosstat.

In April, the mortality rate rose even higher! Up to 168 thousand. In some regions, the mortality rate soared by 15-40%, such data was published by demographer Raksha based on registry office data. Closing the demographic data was a matter of time in the conditions of war.

This does not fit at all with Medinsky’s bravura statements in Istanbul, where he said that Russia can fight for a long time. What happened to these bravura warriors that they closed all the statistics? This does not fit at all with the public rhetoric!

https://bsky.app/profile/evgen-istrebin.bsky.social/post/3lpfd42vsdc2r

15,908 posted on 05/18/2025 2:18:06 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15907 | View Replies]

To: AdmSmith

“the birth rate fell... the mortality rate rose even higher!”

Putin is the Doom of Russia.

Someone needs to stop him - he can’t stop himself.


15,909 posted on 05/18/2025 2:23:29 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15908 | View Replies]

To: BeauBo
Someone needs to stop him

Are you calling..?

It might be a good time to take your hate down a few notches.

15,910 posted on 05/18/2025 2:27:08 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15909 | View Replies]

To: BeauBo

It’s genuinely worth watching this stuff once in a while if you work in defence and security, or govt policy circles. It’s clearly raving madness but it’s what Russian people are being conditioned with every day, and have been being so for years now.

Anton Geraschenko: Russian propagandists are discussing the best way to destroy Europe: with nuclear and missile weapons, or with gas and chemical weapons. “Honestly, Europe — and the liberal global elite in general — needs to be broken. It needs to be broken.”

https://bsky.app/profile/justin-br0nk.bsky.social/post/3lphl5uckes26

43s video

Keir Giles: Just arrived in Rome for NATO Defense College where I’ll be doing the same old trick of showing the baby generals and admirals some similar Russian destroy-the-West war propaganda and then “What year is this from? 2025? No, this one’s from 2012 and it’s been constant since then.”


15,911 posted on 05/18/2025 2:29:21 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15909 | View Replies]

To: BeauBo
Putin won’t stop, he must be stopped.

?

15,912 posted on 05/18/2025 2:29:26 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15906 | View Replies]

To: AdmSmith

973,730 Russian casualties - racing toward a million.

President Trump wants to stop putin.

Mad dog putin needs to be stopped.


15,913 posted on 05/18/2025 5:43:02 PM PDT by BeauBo
[ Post Reply | Private Reply | To 15907 | View Replies]

To: AdmSmith

Just like China is doing,” all is going so well we don’t need to report numbers…”😂


15,914 posted on 05/18/2025 6:28:09 PM PDT by blitz128
[ Post Reply | Private Reply | To 15908 | View Replies]

To: PIF

He thinks he is so smart, must pain him to be on the outside looking. I know who you are talking about, game of monopoly anyone😂


15,915 posted on 05/18/2025 6:31:56 PM PDT by blitz128
[ Post Reply | Private Reply | To 15902 | View Replies]

To: gleeaikin; BeauBo
Russian Offensive Campaign Assessment, May 18, 2025

Russian forces conducted the largest single drone strike of the war against Ukraine on the night of May 17 to 18 – in disregard of US President Donald Trump's calls for Russia to stop long-range strikes against Ukraine, particularly against Kyiv Oblast.[1] The Ukrainian Air Force reported that Russian forces launched 273 Shahed and decoy drones from the directions of Bryansk, Kursk, and Oryol cities; Millerovo, Rostov Oblast; and Primorsko-Akhtarsk, Krasnodar Krai.[2] The Ukrainian Air Force reported that Ukrainian forces shot down 88 drones over eastern, northern, and central Ukraine; that 128 decoy drones were “lost in location;” and that one drone was still in Ukrainian airspace as of 0800 local time. Ukrainian officials reported that the Russian strike largely targeted Kyiv Oblast and that drones struck Kyiv, Dnipropetrovsk, and Donetsk oblasts.[3] Russian forces launched 267 drones (and three ballistic missiles) in their overnight strike series against Ukraine on the night of February 22 and 23.[4] Russian forces have significantly intensified their nightly strikes against Ukraine over the last five months and have conducted several of the largest strikes of the entire war since January 2025. A Russian milblogger claimed that the May 17-18 record-breaking strike was effective due to Russia's use of the “Geran-3” drone (the Russian analogue to the Iranian Shahed-238), which is reportedly equipped with a turbo jet and 300-kilogram warhead.[5] ISW continues to assess that Russian forces are innovating their long-range drone strike tactics in order to offset the effectiveness of Ukrainian mobile defense units and overwhelm the Ukrainian air defense umbrella.[6]

The Kremlin continues efforts to project Russia's military strength ahead of US President Donald Trump's scheduled phone call with Putin on May 19. Kremlin journalist Pavel Zarubin published on May 18 excerpts of an allegedly “new” interview with Putin, in which Putin claimed that Russia has enough manpower and materiel to bring the war in Ukraine to its “logical” conclusion with the “necessary” results for Russia.[7] Putin reiterated long-standing Kremlin narratives about the necessity that peace negotiations address the war's “root causes” and “protect” of Russian-speakers of Ukraine, whom Putin claimed consider Russia their “motherland.” Ukrainian outlet The Kyiv Independent and Russian state media reported on May 18 that the excerpts that Zarubin published on May 18 are unaired footage from the documentary “Russia.Kremlin.Putin.25 Years” that the Kremlin published on May 4 in which Putin repeatedly promoted claims about Russia's ability to bring the war to its “logical conclusion.”[8] The Kremlin's decision to delay publishing these clips until May 18 suggests that the Kremlin is trying to project a strong, militarily superior Russia to the West and to domestic Russian audiences ahead of Putin's May 19 phone call with Trump. Russian Presidential Aide Vladimir Medinsky recently stated that Russia is prepared to fight for “however long it takes,” and Russian Security Council Secretary Dmitry Medvedev recently made thinly veiled nuclear threats in reference to what Medvedev categorized as “negotiating ultimatums.”[9]

Putin is attempting to distract from Russia's military and economic challenges with this rhetoric. Finnish President Alexander Stubb stated during an interview with UK outlet the Guardian published on May 18 that the Kremlin is falsely posturing its economy and military as strong.[10] Stubb noted that Russia has depleted its financial reserves and that the Russian interest rate is over 20 percent. ISW continues to assess that Russian forces are sustaining significant battlefield losses at rates that are likely unsustainable in the medium- to long-term and that Putin has mismanaged Russia's economy, which is suffering from unsustainable war spending, growing inflation, significant labor shortages, and reductions in Russia's sovereign wealth fund.[11] The continued depletion of Russian materiel, personnel, and economic resources at the current rate will likely present Putin with difficult decision points in 2026 or 2027.[12]

Reported support within the Russian military and society for continuing the war until Russia achieves its original war aims and territorial demands reflects the success of the Kremlin's years-long narrative efforts to justify a protracted war effort. The New York Times (NYT) reported on May 17 that interviews with 11 Russian soldiers who are currently fighting or have fought in Ukraine demonstrate that some Russian troops are against an unconditional ceasefire and believe that Russia should keep fighting until Russian forces have seized the entirety of Luhansk, Donetsk, Zaporizhia, and Kherson oblasts.[13] Russian soldiers reportedly called for Russia to continue the war until it reaches its territorial goals and not offer any concessions to Ukraine or the West so that Russia does not have to fight Ukraine again in five or 10 years and so that Russian casualties thus far in the war will not have been in vain.

The NYT noted that an unpublished mid-April 2025 poll by independent Russian opposition polling organization Chronicles found that roughly half of respondents said that they would not support a peace deal that falls short of Russian President Vladimir Putin's initial war aims of Ukrainian “denazification,” demilitarization, and neutrality. Russian opposition outlet Verstka conducted a poll of 100 Russian military personnel in April 2025 in which only 18 percent said they would support a Russian withdrawal from Ukraine prior to achieving Putin's stated war goals and only about a fifth of respondents indicated that they thought the war would end in the coming months.[14] ISW continues to assess that the Kremlin has not been preparing the Russian information space for a peace agreement in the near future and that Russian forces and society do not anticipate an imminent end to the war.[15] The Kremlin has been engaged in a concerted effort to justify Putin's war aims as existential to the Russian state and to garner societal support for the protraction of the war until Russia achieves these goals. Kremlin officials are increasingly publicly stating that Russia is prepared to continue fighting until Ukraine accepts Russia's demands, likely because the Kremlin assesses that it has adequately prepared Russian society and the Russian military for such a scenario.[16]

Ukrainian President Volodymyr Zelensky continues efforts to negotiate a diplomatic end to the war in Ukraine. Zelensky spoke with US Vice President JD Vance and US Secretary of State Marco Rubio in Rome on May 18 and highlighted the importance of an unconditional ceasefire in Ukraine and Ukraine's willingness to engage in meaningful diplomacy.[17] Zelensky underscored that the Russian delegation presented unrealistic and unacceptable terms during the May 16 Ukrainian–Russian talks in Istanbul. Rubio had a call on May 17 with Russian Foreign Minister Sergei Lavrov, during which Rubio reiterated the Trump administration's call for an immediate ceasefire in Ukraine.[18] Ukraine continues to demonstrate its willingness to establish meaningful peace dialogues and commit to an unconditional ceasefire.[19] Russia, however, continues to demonstrate that it is not interested in a ceasefire or in good faith negotiations to end the war.[20]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-18-2025

15,916 posted on 05/18/2025 10:10:08 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15890 | View Replies]

To: blitz128

“ I am sure he will continue to spew “content””

It is just a much better gig than going to the Army.


15,917 posted on 05/19/2025 12:34:58 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15893 | View Replies]

To: AdmSmith

Curious who they “polled”? Moscow and St. Petersburg or the rest of the country that has been dying for pitin’s dreams.


15,918 posted on 05/19/2025 3:09:36 AM PDT by blitz128
[ Post Reply | Private Reply | To 15916 | View Replies]

To: BeauBo; mcdonald
🍈

Mad dog putin needs to be stopped.

This sounds like you're advocating for The Unthinkable.

Please, there is no place here for that.

15,919 posted on 05/19/2025 4:40:28 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15913 | View Replies]

Fun Fact:

Liz Cheney and Dick Cheney endorsed Kamala Harris and all three supported Zelensky and war in Ukraine.

You do too.

15,920 posted on 05/19/2025 4:56:29 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15919 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,881-15,90015,901-15,92015,921-15,940 ... 21,481-21,489 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson