Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,921-14,94014,941-14,96014,961-14,980 ... 19,061-19,062 next last
To: FtrPilot

Partisans!

We get up in the morning and go to work - they get up in the morning and go to work.

Just as the Russian economy is exceptionally dependent on oil and gas, logistics within Russia is extraordinarily dependent on rail:

Number of fires at Russian railroads increases in March, Military Intelligence says

Kyiv Independent reports:

“Railroad fires increased in several Russian regions in March, Ukraine’s military intelligence (HUR) said on April 16.

Railways are a key means of transportation used by the Russian army to carry equipment and personnel to the combat zone in Ukraine and Russia’s Kursk Oblast, which the Ukrainian military entered in August 2024.

Pro-Ukrainian partisans regularly sabotage railroads to hinder Russian military efforts.

The March fires destroyed six units of traction rolling stock in Moscow, Samara, and Tver oblasts, as well as nine railway signaling, centralization, and interlocking devices in the Republic of Mari El, Stavropol, and Krasnoyarsk regions, according to military intelligence.

In Moscow Oblast, a power transformer and a tank car with fuel also burned down.

“The fight against the supply of ammunition and military equipment to the Russian occupation army by rail continues,” the statement read.”


14,941 posted on 04/16/2025 4:54:09 PM PDT by BeauBo
[ Post Reply | Private Reply | To 14904 | View Replies]

To: BeauBo

A topic not often discussed is Russia’s loss of revenue from military exports. Once the second largest source of revenue for Russia is nearly gone, and to make matters worse it will likely never return.

Besides the battlefield exposure of the weaknesses of Russian weapons there are many new entrants into the weapons manufacturing market like SK, India and even Poland and Ukraine.

Putin remains master economist 😎


14,942 posted on 04/17/2025 3:34:37 AM PDT by blitz128
[ Post Reply | Private Reply | To 14940 | View Replies]

To: PIF

Russian advantage in artillery and glide bomb attacks continues to be reduced, but beyond that Ukraine must be more judicious in their use of these weapons because they have less capacity and capability.

Russia uses their advantage more as a terror factor than as an effective tactical strategy.

Reminds me of entire farm field pot marked with artillery craters. Unlikely that those field were filled with Ukrainian soldiers, rather it gave the commanders the ability to report they sent X number of rounds down range. Having little effect, but to drain sticks of ammunition and burn up barrels.


14,943 posted on 04/17/2025 3:42:47 AM PDT by blitz128
[ Post Reply | Private Reply | To 14938 | View Replies]

To: BeauBo
“Railroad fires increased in several Russian regions in March, Ukraine's military intelligence (HUR) said on April 16.

Fire info the last week https://firms.modaps.eosdis.nasa.gov/map/#d:7days;@57.8,53.8,5.0z

and the last 24 h https://firms.modaps.eosdis.nasa.gov/map/#d:24hrs;@48.2,51.4,6.0z

14,944 posted on 04/17/2025 4:16:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14941 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, April 16, 2025

Russia is reportedly heavily dependent on North Korean artillery ammunition as North Korea continues to learn lessons from Russia's war against Ukraine. Reuters published a joint investigation with UK-based research organization Open Source Center (OSC) on April 15 detailing the extent of Russia's dependence on North Korean artillery and the evolution of North Korean forces’ participation in fighting alongside Russian forces.[7] Reuters and the OSC tracked 64 shipments from North Korea to Russia from September 2023 to March 2025 that involved 16,000 containers carrying millions of North Korean artillery rounds and recorded a shipment from North Korea as recently as March 17, 2025. Reuters and the OSC reported that four Russian-flagged ships — the Angara, Maria, Maia-1, and Lady R cargo ships — transported the ammunition from North Korea's port of Rajin to the Russian ports of Vostochny and Dunai. Reuters reviewed Russian military documents of everyday Russian artillery usage that showed that some Russian units depended on North Korean artillery shells for half or more of their shells used in daily fire missions. Reuters reported that an unspecified Russian unit fighting in Zaporizhia Oblast reported that nearly 50 percent of its 152mm D-20 howitzer rounds and 100 percent of its 122mm rockets fired came from North Korea. Ukraine's Main Military Intelligence Directorate (GUR) told Reuters that North Korea has provided Russia with three million artillery rounds and an unspecified number of mortar rounds since mid-2023 and that half of all of Russia's artillery rounds come from North Korea. The GUR also stated that North Korea supplied Russia with 148 KN-23 and KN-24 ballistic missiles as of January 2025.

Ukrainian military commanders and intelligence continue to indicate that North Korean forces have innovated their training and battlefield tactics following their participation in Russia's war. A Ukrainian regimental commander fighting in Kursk Oblast told Reuters that 3,000 additional North Korean forces that arrived in Kursk Oblast in mid-February 2025 were better prepared and more “adapted to modern combat” than the original contingent of North Korean forces that began fighting alongside Russian forces in November 2024.[8] GUR Spokesperson Andriy Chernyak stated on April 15 that North Korean forces have changed tactics from conducting assaults in large groups to attacking in groups of one or two people, have learned drone and electronic warfare (EW) tactics, and are successfully using Russian weapons and tactics on the battlefield.[9] Chernyak indicated that Russian and North Korean forces are somewhat compensating for language barriers that were causing friction during combat operations, as North Korean forces now receive orders and conduct assaults without communicating with Russian units.

Russian authorities recently detained former Kursk Oblast Governor Alexei Smirnov, likely as part of the Kremlin efforts to scapegoat Kursk Oblast officials for their failure in responding to Ukraine's August 2024 incursion into Kursk Oblast. Russian law enforcement officials told Kremlin newswire TASS on April 16 that Russian authorities detained Smirnov and former Kursk Oblast Vice Governor Alexei Dedov on suspicions of fraud and will seek their arrests.[10] Russian law enforcement authorities claimed that Smirnov and Dedov are under investigation for embezzling funds from the state-owned Kursk Oblast Development Corporation (KODC) meant for constructing defensive fortifications in the Kursk Oblast border area.[11] Russian authorities previously detained KODC executives in December 2024 on similar charges of embezzlement, in what ISW assessed at the time to be a concerted Kremlin effort to scapegoat Kursk Oblast officials for failing to repel Ukraine's incursion.[12] Russian officials notably arrested former 58th Combined Arms Army (CAA) Commander Major General Ivan Popov in May 2024 on similar charges of embezzling funds dedicated to constructing fortifications due to his perceived disloyalty and criticisms of the Russian military high command.[13]

Russian President Vladimir Putin replaced Smirnov as Kursk Oblast Governor with then Russian State Duma Information Policy Committee Head Alexander Khinshtein on December 5, 2024, and claimed that Smirnov resigned “at his own request.”[14] Senior Russian officials emphasized in December 2024 that Putin appointed Khinshtein because Smirnov did not adequately communicate with or support Kursk Oblast residents regarding housing issues but did not accuse Smirnov of corruption at that time.[15] ISW previously assessed that the Kremlin refrained from replacing Smirnov directly following the Ukrainian incursion or during Russian regional elections, likely in support of efforts to downplay the societal impacts of the incursion.[16] The Kremlin likely detained Smirnov and Dedov now since Russian forces have mostly pushed Ukrainian forces out of Kursk Oblast.[17]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-16-2025

14,945 posted on 04/17/2025 4:27:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14924 | View Replies]

To: blitz128
Dumb, Dumber and Evil


14,946 posted on 04/17/2025 4:30:34 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14943 | View Replies]

Together, they started 10 wars, killed more than one million civilians while adding nearly $7 trillion dollars to our national debt.

Donald Trump, 4 years of Peace and Prosperity while fighting the entire Global Deep State alone. President Trump is currently facing 700 years in prison for a business booking error.


14,947 posted on 04/17/2025 4:31:05 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14946 | View Replies]

To: JonPreston
Go Ukraine!


14,948 posted on 04/17/2025 4:31:31 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14947 | View Replies]

To: JonPreston


14,949 posted on 04/17/2025 4:31:58 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14948 | View Replies]

To: JonPreston

14,950 posted on 04/17/2025 4:32:18 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14949 | View Replies]

To: JonPreston
🍈


14,951 posted on 04/17/2025 4:32:35 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14950 | View Replies]

To: AdmSmith
WINNING: @GrandpaRoy2 reports that UKR is dominating the drone war--

Ukraine is now producing millions of drones, and some UKR operators fly 15 missions a day, while a Russian operator says they get 10-15 FPVs per battalion per week.

https://x.com/ChuckPfarrer/status/1912595500320366631


14,952 posted on 04/17/2025 4:37:25 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14945 | View Replies]

To: FtrPilot
Day 1,148 of the Russian invasion. 1,230 [average is 817/day], i.e. more than 51 Russians and Norks/h. AFV more than 175%, vehicles and fuel tanks more than 335%, tanks more than 70% and artillery more than 180% above average.


14,953 posted on 04/17/2025 4:41:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14926 | View Replies]

To: BeauBo
🇩🇪 Germany expands military aid to Ukraine:

🔹 MRAPs: Now 269 (was 203)
🔹 GEPARD ammo: 330,000 rounds (was 292,000)
🔹 Zuzana 2 SPGs: 9 (was 6)
🔹 155mm shells: 454K (was 427K)
🔹 VECTOR drones: 619 (was 549)
🔹 HF-1 drones: 1,050 (was 900)
🔹 Unmanned vessels: 80 (was 70)
🔹 Bergepanzer 2: 28 (was 22)
🔹 WISENT 1 deminers: 65 (was 61)
🔹 Laser rangefinders: 1,508 (was 1,321)
🔹 Infrared binocs: 347 (was 255)
🔹 Underwater scooters: 100 (was 45)
🔹 RGW-90 AT weapons: 16,917 (was 16,000)
🔹 MK 556 rifles: 5,800 (was 5,000)
🔹 Tourniquets: 493,400 (was 343,400)
🔹 Sleeping bags: 15,300 (was 14,766)

https://x.com/NOELreports/status/1912831384139288595


14,954 posted on 04/17/2025 4:42:29 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14952 | View Replies]

To: BeauBo

also the Russian logistics system is a manual one - hand loaded and unloaded, no invoices, no manifests, no pallets, no plastic wraps - cargo put into random piles, and then sorted through by various troops to find the needed items which are then hand loaded onto trucks and unloaded the same way.


14,955 posted on 04/17/2025 4:46:46 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14941 | View Replies]

To: FtrPilot; blitz128; PIF; BeauBo; AdmSmith; zeeper
🍈

I'll need additional postings from you guys today. Our numbers are way down

UKRAINE: Zelensky is actively training child soldiers as young as 10. The danger with the program is that the kids become legitimate military targets.

pic.twitter.com/WEtiOeOgMu— @amuse (@amuse) April 17, 2025


14,956 posted on 04/17/2025 4:46:48 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14954 | View Replies]

To: PIF
Кремлевская табакерка
The Germans make things” - why the Chinese auto industry is leaving Russia

Over the past few years, we have reported in detail on the adventures of the Chinese auto industry in Russia. And on the unsuccessful attempts to transfer officials to domestically produced products. It is no longer a secret that about ten Chinese car brands will leave the Russian market. Our colleagues from Kommersant wrote about this in more detail.

What is important (and our colleagues did not write about this) is that Russians refuse to drive not only Chinese cars, but also ours. “Many are waiting for the sanctions to be lifted. Chinese cars look cool, but they freeze in our winter conditions, the electronics do not work, the plastic cracks. They are not adapted, alas,” a source in the market told us. He does not hide the fact that there is a great demand for cars from Europe.

“They want high-quality Germans, economical Japanese. They are ready to overpay. But prices have already flown into space,” the interlocutor said. The source declined to predict whether Russians are ready to continue driving Russian and Chinese cars if sanctions continue.

https://t.me/kremlin_secrets/5549

14,957 posted on 04/17/2025 4:47:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14954 | View Replies]

To: PIF
Footage from the 71st Jaeger Brigade, repelling a mass Russian mechanized attack. Possibly the Velyka Novosilka axis as this brigade is active there. Lately, Russia has (re)started using large mechanized columns again.

https://x.com/NOELreports/status/1912808682171007033


14,958 posted on 04/17/2025 4:51:00 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14954 | View Replies]

To: blitz128
Just the day before yesterday, Russian propagandists were salivating, talking about the ruble as the strongest currency in the world, and already yesterday, the Politburo discussed the question of to what level to devalue the same ruble in order to somehow support the budget. It should be noted that the experts proposed several options from which representatives of the Russian leadership tried to choose the best one. Thus, during the discussion, they came to the conclusion that less than 100 rubles per US dollar should not even be considered, and the corridor between 120 and 150 looks quite acceptable. But by the end of the year, the corridor should smoothly shift to 140-180 rubles per US dollar, and under negative circumstances, the limit of 220 is more than likely.

Hopes for the wizard Trump have vanished, and pessimism and despondency have returned to replace hopes. The European Union will only increase sanctions against Russia, and if the US reaches an agreement with Iran and lifts the main sanctions against Tehran, the price of oil on the world market will fall to a critical level. This will be a serious shock for the Russian economy, not to mention the possible introduction of new sanctions by the US. Of course, it is possible to call up another million people, not pay them, and suggest that the country unite, but this is an extremely risky decision even for the Politburo.

https://t.me/generalsvr/3115

14,959 posted on 04/17/2025 4:51:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14957 | View Replies]

To: blitz128
Battle for Nadiya: MLRS volleys, tank fire, and assault teams from Ukraine’s 3rd Assault Brigade push forward under cover of M113s. Infantry stormed Russian positions with rifle fire, carving a path to liberate the village.

https://x.com/NOELreports/status/1912811619899285538


14,960 posted on 04/17/2025 4:53:44 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14958 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,921-14,94014,941-14,96014,961-14,980 ... 19,061-19,062 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson