Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; gopgallery; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,781-14,80014,801-14,82014,821-14,840 ... 22,681-22,693 next last
To: JonPreston
๐Ÿˆ

(LAST)

14,801 posted on 04/12/2025 2:16:08 AM PDT by JonPreston ( โœŒ โ˜ฎ๏ธ )
[ Post Reply | Private Reply | To 14800 | View Replies]

Day 1,143 of the Russian invasion. 1,240 [average is 814/day], i.e. more than 51 Russians and Norks/h. Vehicles and fuel tanks more than 230% and artillery more than 110% above average.


14,802 posted on 04/12/2025 3:14:47 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14767 | View Replies]

To: FtrPilot; PIF; All

Ukrainian F-16 shot down near Sumy on a combat mission.


14,803 posted on 04/12/2025 4:43:49 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 14756 | View Replies]

To: marcusmaximus
ooh! ooh! Plane down! Russia!!


14,804 posted on 04/12/2025 6:15:56 AM PDT by JonPreston ( โœŒ โ˜ฎ๏ธ )
[ Post Reply | Private Reply | To 14803 | View Replies]

To: marcusmaximus

Is this the guy who constantly calls us โ€œblood thirstyโ€ ๐Ÿˆlol

Was the F-16 an irreplaceable strategic bomber?

Besides we were told all the F-16s would be destroyed the day that landed in Ukraine, so how can one be shot down๐Ÿค”


14,805 posted on 04/12/2025 6:38:23 AM PDT by blitz128
[ Post Reply | Private Reply | To 14803 | View Replies]

To: AdmSmith

โ€œ Yes, Muscovy Central Bank: If the SVO does not end by the summer, or at the latest in June, a terrible, very severe crisis will hit the Russian economy.โ€

I guess like Christmas the orthodox Russians have a different start date for summer

Summer starts jun 20th ๐Ÿค”

And ๐Ÿˆ why is the central bank talking about Moscow international airport(SVO)๐Ÿ˜‚


14,806 posted on 04/12/2025 6:47:42 AM PDT by blitz128
[ Post Reply | Private Reply | To 14791 | View Replies]

To: BeauBo

Went from surplus to debt
Putin is indeed a master economist


14,807 posted on 04/12/2025 6:49:07 AM PDT by blitz128
[ Post Reply | Private Reply | To 14790 | View Replies]

To: AdmSmith

๐Ÿˆ speaks of โ€œourโ€ lol
โ€œI am literally outside wildberry warehouse โ€œ

I have served all over the world, but have never been in Russia or โ€œliterally โ€œ outside a burning Russian warehouse๐Ÿ˜‚


14,808 posted on 04/12/2025 6:53:27 AM PDT by blitz128
[ Post Reply | Private Reply | To 14784 | View Replies]

To: AdmSmith

Troop and tank numbers look good, vehicles and tankers numbers are a bit deceiving as many of those are acting as combat assets or UCPC(unarmored civilian personnel carrier๐Ÿ˜‚)

Nothing like charging the front in your microbus


14,809 posted on 04/12/2025 6:59:18 AM PDT by blitz128
[ Post Reply | Private Reply | To 14802 | View Replies]

To: AdmSmith

“Muscovy Central Bank: If the SVO does not end by the summer, or at the latest in June, a terrible, very severe crisis will hit the Russian economy.”

Well they certainly have much better visibility into when Russia’s financial reserves run out, and the rising tide of Debt and bankruptcies facing their economy.

But even that dire forecast was before Global oil prices dropped. They certainly cannot afford to have President Trump put secondary sanctions on buyers of Russian oil.

Russia needs a deal, or Putin is going to inflict far more damage on Russia, than many are expecting.


14,810 posted on 04/12/2025 7:08:23 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14791 | View Replies]

To: AdmSmith

“ISW continues to assess that the Kremlin is unable to provide ever-increasing financial incentives to boost recruitment efforts as Russia is forced to confront compounding economic challenges.”

One thing about an economic crisis however, is that it makes Military recruiting easier, when more men are out of work.


14,811 posted on 04/12/2025 7:11:02 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14792 | View Replies]

To: blitz128

“Went from surplus to debt”

Vlad RusDoom, the destroyer of Russia.


14,812 posted on 04/12/2025 7:15:29 AM PDT by BeauBo
[ Post Reply | Private Reply | To 14807 | View Replies]

To: blitz128; PIF; dimwit
๐Ÿˆ

Steve Witkoff salutes The Putin in Ruzzia!


14,813 posted on 04/12/2025 7:31:01 AM PDT by JonPreston ( โœŒ โ˜ฎ๏ธ )
[ Post Reply | Private Reply | To 14805 | View Replies]

To: stupid
๐Ÿˆ

OOH! OOH! Plane down!!


14,814 posted on 04/12/2025 7:34:09 AM PDT by JonPreston ( โœŒ โ˜ฎ๏ธ )
[ Post Reply | Private Reply | To 14809 | View Replies]

To: marcusmaximus; SpeedyInTexas; blitz128; russia; All
๐Ÿˆ

NATO was created as a tool of the Cold War to fight the Soviet Union and so-called Warsaw Pact. Now, there is neither the Warsaw Pact nor the Soviet Union, but NATO still exists.

Why?

Answer: Because Russia and the Soviet Union are NOT the same and NATO is now an instrument of GLOBALIST foreign policy


14,815 posted on 04/12/2025 8:03:22 AM PDT by JonPreston ( โœŒ โ˜ฎ๏ธ )
[ Post Reply | Private Reply | To 14803 | View Replies]

To: blitz128
"Nothing like charging the front in your microbus"

โœŠ ๐Ÿ˜Ž NGU "Azov" Brigade in Toretsk repelled Russian assault on its positions.

๐Ÿ˜ณ The enemy decided to storm on Bukhanka, Niva and UAZs.

https://x.com/Maks_NAFO_FELLA/status/1911067500109852711


14,816 posted on 04/12/2025 8:04:55 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14809 | View Replies]

To: PIF
๐Ÿš€ ๐Ÿ’ฅ M142 HIMARS destroys Russian Buk-M2 system in eastern direction.

https://x.com/Maks_NAFO_FELLA/status/1911046891866902802


14,817 posted on 04/12/2025 8:06:27 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14816 | View Replies]

To: All
๐Ÿ‡บ๐Ÿ‡ฆ Ukraine can now independently produce FrankenSAM air defense systems. Kyiv has received the technical documentation and is fully capable of implementing the project on its own, said Presidential Advisor Oleksandr Kamyshin.

https://x.com/NOELreports/status/1910817131471437860

A Ukrainian FrankenSAM - a soviet Buk-M1 with the US RIM-7 Sea Sparrow missiles.

14,818 posted on 04/12/2025 8:12:48 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14817 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.
โ€”

[ Sole Ukrainian Machine Gunner Stands His Ground Against an Entire Russian Assault Unit! ]

Today [ Apr 11, 8 pm ], there are a lot of important updates from the Pokrovsk direction.

Here, the Russians are sending waves of infantry assaults across the Pokrovsk direction, throwing bodies at the front in a desperate attempt to stall the Ukrainian advance. But with no armor, no cover, and no chance of surprise, they’re being met with the brutal efficiency of Ukrainian machine gun nests that are mowing down reckless Russian assaults that backfired hard.

The goal of the Russians in this area is to stall the Ukrainian counteroffensive effort and prevent them from regaining the operational initiative. This is because of the Ukrainian tactical successes, which resulted in them retaking several key positions at Pischane, Kotlyne, Shevchenko, and Solone, allowing them to tighten the noose around the Russian western flank.

Continued Ukrainian advance would result in the complete elimination of the Russian pincer, which is why the Russian forces are doing everything they can to preserve it at any cost, throwing endless waves of meat wave assaults at the Ukrainian lines. This way, the Russian commanders hope to overwhelm the Ukrainian forces with sheer numbers, hoping Ukrainians would be forced on the defensive and cease their offensive efforts on the western flank of Pokrovsk.

However, the Russians had already exhausted their reserves in this area as they ran out of steam for continued assaults. To solve this, Russian commanders redeployed forces from other sectors of the front, allowing them to fulfill their manpower needs for the meat wave assaults.

However, they could not solve the problem of a shortage in armored vehicles, as the issue was gripping Russians all over the frontline in Ukraine. As you might remember, the lack of armored vehicles forced Russians to use civilian cars and pickup trucks for the assaults instead.

With the problem solved in the eyes of the Russian high command, Russian forces increased the intensity of their attacks to the same level of intensity as during their initial attempt to take Pokrovsk into a pincer. However, contrary to how Russians gained significant ground here during that time, they barely made any advancements at all.

Zooming into Uspenivka to use as an example, Ukrainians used drones to scatter landmines across the main hardened road Russians used.

Additionally, Ukrainian drone operators targeted any Russian vehicle moving into the settlement, as well as any Russian soldiers that managed to dismount and tried to move into the buildings. This way, a single Ukrainian drone team reported they were eliminating up to 20 Russian soldiers a day, further underscoring the high casualty rate of Russian tactics.

Additionally, geolocated combat footage reveals how periodic heavy rain made the unmaintained frontline roads extremely slippery, causing one driver to lose control of the vehicle and drive straight into a landmine placed on the side of the road. Additional footage shows how Russians drove one Bukhanka van up to Uspenivka, which had already been detected on the approaches by a Ukrainian reconnaissance drone.

This allowed the Ukrainian fighters in the settlement to quickly leave their concealed positions, and set up a machine gun to meet the Russian assault head-on. Ukrainian soldiers opened fire on the vehicle, which provided zero protection for the Russian soldiers crammed inside, as the bullets tore through the vehicle. After this, the Ukrainian fighters quickly and safely returned to their concealed positions, ready to repulse the next Russian car assault.

Aftermath footage shows how the Ukrainian machine gun had utterly devastated the Russian van, igniting the exposed fuel tank, leaving the vehicle a burning wreck as fallen Russian soldiers lay around it, most of whom did not even make it off. The footage also shows a high number of destroyed Russian civilian cars scattered in front of the town, signaling that Russians continue to launch assaults with the same tactic, despite failing time and time again.

Overall, the Russians are trying to stall the Ukrainian offensive by throwing a continuous wave of bodies at Ukrainian lines. While this is effective in results only, Ukrainians are allowing the already depleted Russian forces to destroy their combat capabilities even more. In the meantime, Ukrainians continue to find weak spots that are ready to be exploited, improving their position on the front.

https://www.youtube.com/watch?v=v959InleGE8


14,819 posted on 04/12/2025 9:36:29 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14818 | View Replies]

To: FtrPilot

Now regarded as front line fighting vehicles by โ€œ2nd greatest military โ€œ๐Ÿ˜‚


14,820 posted on 04/12/2025 10:36:40 AM PDT by blitz128
[ Post Reply | Private Reply | To 14816 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,781-14,80014,801-14,82014,821-14,840 ... 22,681-22,693 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson