Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,741-14,76014,761-14,78014,781-14,800 ... 21,461-21,467 next last
To: blitz128
🇷🇺 🚜 Russia's latest military innovation: troops now attacking in GAZ-69 "Kozlik" vehicles—produced in the USSR from 1953 to 1973.

https://x.com/NOELreports/status/1910625055907659835


14,761 posted on 04/11/2025 4:31:28 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14760 | View Replies]

To: BeauBo
The 155th 'Anne de Kyiv' Brigade actively destroying Russian personnel in the Pokrovsk sector.

https://x.com/NOELreports/status/1910452677089137086

It appears that the UKF infantry are in direct communication with the drone pilots.

14,762 posted on 04/11/2025 4:39:51 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14761 | View Replies]

To: PIF
Mercenaries from 🇨🇳 China and Africa are preparing to be sent to the combat zone as part of the 🇷🇺 Russian Armed Forces.

https://x.com/GloOouD/status/1910644760936689856


14,763 posted on 04/11/2025 4:47:44 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14762 | View Replies]

To: BeauBo

How Russia turns conscripts into contract soldiers and what happens to them, for example:

Anton Gerashchenko@Gerashchenko_en

“On the way, mortars blew up all the vehicles. I was the only one alive out of 36 men. There are a lot of Russian corpses lying along the road, soldiers without heads, without arms. Nobody pays attention to them and nobody collects them.”

Tursunbaev Yorkinbek Vadijon oglu, callsign “Bek,” from the 331st Motor Rifle Regiment, native of Uzbekistan. He was forced to sign a contract and was given a Russian passport right in prison.

He was captured near Chasiv Yar, having been on the battlefield for only 3 days. According to him, those who did not want to go on an assault were threatened with being shot. And if the soldiers did not obey the commander’s orders, they were “beaten to death.”

Video with translation:

https://x.com/Gerashchenko_en/status/1910395024887464143?ref_src=twsrc%5Etfw%7Ctwcamp%5Etweetembed%7Ctwterm%5E1910395024887464143%7Ctwgr%5Eeb36be089ecef507468aef1b5c075dc6ade10d79%7Ctwcon%5Es1_c10&ref_url=https%3A%2F%2Fwww.gopbriefingroom.com%2Findex.php%3Ftopic%3D556204.450


14,764 posted on 04/11/2025 5:50:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14757 | View Replies]

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russians Hunt Down Deserters Who Tried to Run Away During The Operation ]

Today [ Apr 10, 8 pm ], there is interesting news from the Lyman direction.

Here, Russian commanders again resorted to one of their favorite and most brutal tactics, employing drone barrier troops to continue the offensive, after their soldiers’ morale had already broken. They did this to instill fear and obedience in their soldiers, in preparation for a renewed push toward Lyman, building up for what could become one of the most brutal offensives of the war.

The Russian strategic goal is to break through Ukrainian lines along the Zherebets River, take control of the area between Zherebets and the Oskil Rivers, and move to sever Ukrainian ground lines of communication.

If successful, Russian forces would aim to press southward and capture Lyman, a gateway into the heavily fortified Ukrainian-held cities of Sloviansk, Kramatorsk, and Siversk in northern Donetsk Oblast.

Such a maneuver would also complement another planned offensive from the south, toward Kostyantynivka, as Russians plan to capture northern Donetsk Oblast, before they are forced to end the war. Russian command seems to be laying the groundwork for a massive, multi-directional offensive that could put Ukrainian defenses under severe pressure.

However, the Russians have faced a significant chokepoint at Torske. The Zherebets River here widens considerably, due to nearby water reservoirs, creating natural bottlenecks that funnel Russian forces into narrow kill zones.

Ukrainian defenders have turned these chokepoints into death traps using drones, tanks, and artillery, waiting for the precise moment to strike the enemy, when they are most vulnerable. Meanwhile, from the south, the dense Serebryanski forest has given Ukrainian units a major advantage for months.

Utilizing drones and artillery from within the forest allowed the Ukrainians to create a death zone for all Russian units advancing toward Torske, striking them before they could even establish a proper foothold, making any progress impossible.

To try and break the stalemate, the Russians have resorted to infiltration tactics along the eastern riverbank.

Small infantry groups are attempting to advance toward Torske from the north and further reinforce the Russian bridgehead at Ivanivka. Yet this approach has proven extremely costly.

Drones have recorded wave after wave of Russian infantry being wiped out by Ukrainian FPV strikes, and the bodies of soldiers are piling up near the crossings.

Despite this, Ukraine’s 63rd Brigade recently intercepted communications between Russian units near Lyman that revealed a disturbing new layer to these tactics.

The recordings proved that Russian commanders are using barrier troops to keep soldiers from retreating. The intercepted message stated that if Russian assault troops, consisting mainly of newly mobilized soldiers, without experience, retreat or hesitate during an assault, their comrades will target them with drones from behind. The Russians in the recording also stated that the order comes straight from Russian high command.

This is a brutal evolution of the traditional barrier troop concept. Rather than having soldiers posted in the rear to shoot deserters, the modern Russian army has now weaponized drones against its own men.

It’s a reflection of just how desperate Russian command has become to maintain momentum, regardless of the cost in lives or morale. It also underscores the growing reliance on untrained, poorly motivated mobilized troops, who must now fear not only the enemy, but their own forces as well.

The result was gruesome. Under threat of execution by their own drone operators, Russian troops have no choice but to continue the assaults. Through sheer numbers and forced compliance, some marginal ground was gained at an enormous human cost, but in the eyes of the Russian leadership, any movement forward, even over mountains of bodies, counts as progress.

Overall, this development underscores the extreme lengths Russia is prepared to go to, to break the deadlock around Lyman and Borova. With mounting troop concentrations and fresh units pouring in despite catastrophic losses, the region has become a strategic focal point. However, with such attritional human wave assaults, the Russian command is effectively undermining its own summer offensive plans, as they are exhausting their manpower resources and risk having no critical buildup of reserves needed for a breakthrough.

https://www.youtube.com/watch?v=_Lr3SRm9gtg


14,765 posted on 04/11/2025 6:11:13 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14764 | View Replies]

To: PIF
Thank you for posting, but this thread is DYING!

Over the past 48 hours there are app. 50 posts, and half of them are mine. If you can't create some interest in this slop, I'm going to petition for it to be closed. After all, Speedy is gone, having called for nuclear war twice and you have advanced the public execution for congressional members who weren't sufficiently pro-Ukranian. This place is PURE #NeverTrump.


14,766 posted on 04/11/2025 6:47:11 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14765 | View Replies]

Day 1,142 of the Russian invasion. 1,210 [average is 814/day], i.e. more than 50 Russians and Norks/h. Vehicles and fuel tanks more than 330% and artillery more than 165% above average.


14,767 posted on 04/11/2025 7:08:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14737 | View Replies]

To: AdmSmith
This guy molested young children in plain sight, and you saluted him for his Ukraine policy


14,768 posted on 04/11/2025 7:10:54 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14767 | View Replies]

To: PIF
Кремлевская табакерка

The head of Crimea wants to demand compensation from the government for the disrupted tourist season. But he is afraid

Sergei Aksyonov is convinced that the government should compensate the Crimeans for the lost profits due to the disrupted tourist season. “Everyone understands that due to the pollution of the Black and Azov Seas with fuel oil, there will be no tourists here. Sergei Valerievich has prepared an appeal to the government, but has not sent it yet. There is a fear that instead of support we may receive a harsh reaction,” said a source close to Aksyonov.

The government responded - there will be no compensation. “Imagine - we will now pay compensation to Crimea. Kuban will get in line. To pay everyone is, excuse me, too much. And there is no need,” said a source in the government. He noted that it is important now to provide quality recreation for needy categories of citizens. In particular, there is an active dialogue about sending public sector workers to North Korea.

https://t.me/kremlin_secrets/5527

Yes, because of the oil spill. LOL!

14,769 posted on 04/11/2025 7:17:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14765 | View Replies]

To: BeauBo
❗️Estonia has detained a Russian shadow fleet tanker in the Baltic Sea for the first time.

KIWALA vessel was headed to Russian Ust-Luga port.

Marine Traffic's notes that KIWALA, designed to transport crude oil, sails under the flag of Djibouti. However, a Djibouti spokesperson said the ship was not on their register.

Estonian authorities used their rights to perform an inspection. They reported that the tanker is under sanctions.

https://x.com/Gerashchenko_en/status/1910678505613836781

Any foreign flagged tanker should be boarded and inspected by Finland or Estonia.

14,770 posted on 04/11/2025 7:37:10 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14763 | View Replies]

To: FtrPilot

Kissed by Vladimir Putin: how Russian president treats kids

https://www.youtube.com/watch?v=lZxoZ_TEsy4
4 min video


14,771 posted on 04/11/2025 7:52:33 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14763 | View Replies]

To: FtrPilot; PIF; BeauBo; blitz128; anyone

UKRAINE: Zelensky told the Trump administration that the US and Ukraine are equals and that talks won’t resume until Trump treats him as an equal. Zelensky recently recounted with glee how he rebuffed Secretary Scott Bessent’s attempt to get the rare-earth metals deal signed… pic.twitter.com/YcUPAaYxIy— @amuse (@amuse) April 11, 2025

UKRAINE: Zelensky told the Trump administration that the US and Ukraine are equals and that talks won’t resume until Trump treats him as an equal.

Zelensky recently recounted with glee how he rebuffed Secretary Scott Bessent’s attempt to get the rare-earth metals deal signed ahead of Zelensky’s visit to the White House. “He told me, ‘You need to sign this now,’” Zelensky said. “I told him, ‘Stop tapping your finger and let’s have a serious discussion.’ I think he expected a very different kind of meeting. But I don’t see Ukraine as some second-tier nation. We speak as equals—or we don’t speak at all.”


14,772 posted on 04/11/2025 8:13:46 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14770 | View Replies]

To: AdmSmith

Fix your own country, AdmSmith


14,773 posted on 04/11/2025 8:14:25 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14771 | View Replies]

To: blitz128
Apr 11, 2025: 5 days of Russian Federation Armed Forces losses (as reported by General Staff of the Armed Forces of #Ukraine) compared to the invasion average: Yellow is below average; Green is above average; the number is the ratio of the day's losses over average.

https://bsky.app/profile/anthrclfrnn.bsky.social/post/3lmj6rxnumk2j

14,774 posted on 04/11/2025 8:19:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14758 | View Replies]

To: JonPreston

While Ukrainian conscripts are dying , Zman plays Napoleon with the same result.

The Ukes were saying they need 30,000 men a month !


14,775 posted on 04/11/2025 8:22:39 AM PDT by OldHarbor
[ Post Reply | Private Reply | To 14772 | View Replies]

To: BeauBo
How Russians will be paid pensions if the birth rate does not increase.

If Russians now pay 22% of their salaries to pay pensions, how much will they have to pay in a couple of decades? The media have already begun to make the most pessimistic forecasts on this topic. Some warn of another increase in the retirement age, while others threaten the prospect of pension cuts. Is it true that due to the demographic crisis there will soon be no one to support the elderly population? URA.RU reports. In its current state, the pension system will last for about 15 years.

According to Alexey Raksha, if everyone in Russia had three children, the retirement age with our life expectancy could be 55 years. If everyone has two children, this age shifts to 65 years. And if all families raise only one child, the possible retirement is pushed back to 80 years. “A decrease in the birth rate by 0.1 child per woman subsequently forces us to raise the retirement age by one year,” he states.

“Given the current demographic situation, by 2040 there may be only one working citizen per pensioner,” the parliamentarian said. “This creates a direct threat to the stability of the distribution mechanism, in which pensions are financed from current contributions from workers.”

“When pensions were first introduced, there were 15 working people per pensioner”

https://ura.news/articles/1036291066

14,776 posted on 04/11/2025 8:29:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14757 | View Replies]

To: PIF
it's time you support President trump


14,777 posted on 04/11/2025 8:31:44 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14772 | View Replies]

To: OldHarbor
While Ukrainian conscripts are dying

Our Zeepers don't care. As long as Russians are dying also, they're good.

14,778 posted on 04/11/2025 8:34:07 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14775 | View Replies]

To: blitz128
🇺🇦 😎 Units of SOF have captured 14 Russian servicemen, including three officers, in the Kursk region over the past few days.

https://x.com/Maks_NAFO_FELLA/status/1910718919641284793

Kursk region!

14,779 posted on 04/11/2025 8:40:23 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14770 | View Replies]

To: gleeaikin
Russia has been flooded with supplies of a new Chinese synthetic drug, carfentanil, which is more dangerous than heroin. If drug couriers with this substance were previously detained extremely rarely, then in 2024-2025, there were a dozen and a half arrests. The drug is a synthetic opioid. Carfentanil is 5 thousand times stronger than heroin and 10 thousand times stronger than morphine. It was developed as a tranquilizer for large animals: elephants, rhinos, buffalo and antelopes.

https://t.me/bankrollo/40960

A person can become a drug dealer or distributor via the Internet and not have any physical contact with the person who supplies them with drugs. By decree of the president, a cyber department was created to combat crime on the Internet, but I cannot yet say how relevant its activities are. Now the most popular drugs are the so-called “salts”, as well as the deadly methadone, which looks like “synthetics”, it is often confused with “bookmarks”, its lethal dose is extremely small,” said Lushnikov. Carfentanil is much more toxic than others and is deadly. It was developed back in the 1970s as a tranquilizer for especially large mammals - elephants, rhinoceroses, buffalo, antelopes. It is not produced in Russia - the main manufacturer in the world is China , from where the drug comes to the regions of the Far East, the Urals and Siberia.

https://news.rambler.ru/world/54496498-smertelnaya-sol-borba-s-narkotorgovtsami-ushla-v-internet/

Authorities in Latvia and Lithuania reported seizing Carfentanil as an illicit drug in the early 2000s.

Around 2016, the United States and Canada reported a dramatic increase in shipment of carfentanil and other strong opioid drugs to customers in North America from Chinese chemical supply firms. In June 2016, the Royal Canadian Mounted Police seized one kilogram of carfentanil shipped from China in a box labeled “printer accessories”. According to the Canada Border Services Agency, the shipment contained 50 million potentially lethal doses of the drug, in containers labeled as toner cartridges for HP LaserJet printers.

https://en.wikipedia.org/wiki/Carfentanil

All countries must help put a stop to these Chinese exports.

14,780 posted on 04/11/2025 8:50:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14776 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,741-14,76014,761-14,78014,781-14,800 ... 21,461-21,467 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson