Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 14,181-14,20014,201-14,22014,221-14,240 ... 21,341-21,343 next last
To: JonPreston
(LAST)
14,201 posted on 03/30/2025 9:23:17 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 14200 | View Replies]

To: BeauBo

Well so much for 47’s made in America theme.

But good, because the only heavy we have was built in 1975 or so and in shipyard for maintenance. And the 3 to be made in America ones?

DHS, which has the Coast Guard, may get one into sea trials this year or early next - the other 2 are exist only on paper. No one at DHS can decide if they should be armed or not and if armed with what.

Please 47, transfer the CG to the Dept of the Navy!!!

Finland does build nuclear powered breakers which are needed to compete in the Arctic with Russia’s fleet of 12 or so dual-reactor powered heavy breakers.

The Finnish-built ones need to have the standard Arctic hull design, not the bastardized hull that is designed to travel the open ocean to Antarctica as well, like the US-made ones. All new Arctic Finnish-made breakers need to be in the 45,000 BHP class to compete, which means they have to be nuclear powered. Meeting the LL9 specification, they have to be able to go through 2.5 metres of ice at 3 knots continuous. [ LL9. Icebreaker category notation (intended for icebreaking operations: in the arctic seas in winter and spring with ice up to 4,0 m thick and in summer and autumn with no restrictions, and capable of forcing the way continuously running in compact ice field up to 2,5 m thick. The total shaft power is not less than 48 mW) ]


14,202 posted on 03/30/2025 9:30:43 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14188 | View Replies]

To: FtrPilot; PIF

Amazingly small drone that poor guy was trying to escape running around thos poles. No wonder Ukes can produce a million of those a year.


14,203 posted on 03/30/2025 9:30:46 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14156 | View Replies]

To: gleeaikin; PIF
Кремлевская табакерка

They want to ban civil servants from having plastic surgery without Putin's personal permission

The reason is how the face of Leningrad Region Governor Alexander Drozdenko changed as a result of the surgery. “Vladimir Vladimirovich didn't recognize him at first during the meeting. And then he asked: why did Drozdenko have plastic surgery, that he is, excuse me, a woman? Vladimir Vladimirovich didn't like this surprise. And who would like it when a man with an unfamiliar face comes to you? Maybe he is some kind of killer or an enemy saboteur,” a source in the Kremlin told us.

According to him, Putin hinted that he does not want such surprises anymore. “That is why we have taken up the development of rules for civil servants. In particular, we plan to ban them from having plastic surgery. More precisely, they will be allowed to do it, but only after Vladimir Vladimirovich personally gives the go-ahead,” the channel's interlocutor noted.

He specified that the new rule will apply to both men and women working in high positions in government bodies.

At the same time, the president, of course, will not be able to control everything. Therefore, it is planned that permission for operations of lower officials will be given by their immediate superiors - governors to their deputies and so on.
https://t.me/kremlin_secrets/5477

well...


14,204 posted on 03/30/2025 9:50:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14203 | View Replies]

To: BeauBo; FtrPilot; AdmSmith; PIF; blitz128; BroJoeK; USA-FRANCE; marcusmaximus; Eleutheria5; ...

Regarding Greenland, why not negotiate a 99 year lease of Greenland with elements of Hong Kong, Macao, US Canal Zone, etc. Also include voting rights of Greenlanders on some aspects of development. For example do they want Malls or Walmart type development, etc. Certainly a much friendlier solution than conquest or coercion. we could even pay an annual rent to Denmark. That aspect should not cost too much and would probably make some powers within Denmark more open to negotiating. If we develop and extract mineral resources a fair payment percent for value of materials we export also a sweetener. Art of the Deal (I read his book around 40 years ago.)


14,205 posted on 03/30/2025 10:06:25 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14188 | View Replies]

To: AdmSmith
Interception of Russian kamikaze drone 'Gerbera' by some new experimental interceptor drone with auto-targeting. By the Main Directorate of Intelligence Ukraine.

https://x.com/bayraktar_1love/status/1906389777143705732

It appears that the interceptor drone locks onto the target drone and then steers itself to intercept the target.

Same logic as a heat seeking missile.


14,206 posted on 03/30/2025 10:11:08 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14204 | View Replies]

To: PIF
🇺🇸 🇫🇮 "US preparing sanctions against Russia if it refuses to ceasefire in Ukraine or violates the regime of silence," — the President of Finland after meeting with Trump

🗣️ "Trump is very impatient with Russia's actions, with this conspiracy and delay in the ceasefire. I tried to explain that this is quite normal behavior of Russia. First you agree on something, and then you put forward conditions again....I myself have seen some of sanctions, if they materialize as such, it will go quite far."

https://x.com/Maks_NAFO_FELLA/status/1906388869001392231


14,207 posted on 03/30/2025 10:15:09 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14206 | View Replies]

To: PIF; AdmSmith; FtrPilot; blitz128; BeauBo

Last I read if remembering correctly we had 3 ice cutters that could only cut 1 meter (1 yard appx.) of ice at 3 knots. Apparently, the Russian icebreaker(s) can cut 3 times as thick ice. Since the Russians were trying to ship some heavy material to Vladivostic for nuclear sub and/or icebreaker, it is a good thing for us their ship sank in the Mediterranian last year while traveling from the Baltic Sea to the Suez Canal. Do we want to be unprepared when Russian nuclear subs with icebreakers travel the Arctic Ocean to northern Canada or Alaska? Hopefully, sinking of that transport has given us a little more time to prepare.


14,208 posted on 03/30/2025 10:24:46 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 14202 | View Replies]

To: BeauBo
🔥 More from "Sudzha" gas metering station!

https://x.com/Maks_NAFO_FELLA/status/1906390775392256151


14,209 posted on 03/30/2025 10:27:19 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14207 | View Replies]

To: blitz128
Ukrainian fighters of the 30th Mechanized Brigade repelled a Russian mechanized assault in the Soledar area of Donetsk region, halting the enemy’s advance.

https://x.com/wartranslated/status/1906378051052573157

Soledar on Google Maps

14,210 posted on 03/30/2025 10:31:03 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 14209 | View Replies]

To: gleeaikin

We have 2 medium duty cutters, but only one heavy. One of the mediums is the Healy which is used around the Great Lakes region and is 25 year old. The other medium is an ice breaking anchor handling tug oil supply vessel, the Aiviq used mostly in Alaska.

Neither of them are a fit for the waters of Greenland. Only the Polar Sea can be used there, whenever it gets out of shipyard.


14,211 posted on 03/30/2025 10:47:22 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14208 | View Replies]

To: gleeaikin

It all sounds great. At the end of the day, Greenland will remain in US orbit, and Denmark will be happy about it.


14,212 posted on 03/30/2025 10:53:08 AM PDT by Eleutheria5 (Every Goliath has his David. Child in need ofand there we CGM system. https://gofund.me/6452dbf1. )
[ Post Reply | Private Reply | To 14205 | View Replies]

To: PIF
Zeepers for Zelensky


14,213 posted on 03/30/2025 11:56:42 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 50 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ It’s on Now! Ukrainians Surge Forward and Take Ground! Fresh APC’s Arrive! ]

Today [ Mar 30, 8 pm ], there are a lot of interesting updates from the Kupiansk direction.

Here, in the northern Kupiansk sector, Ukrainian forces are deploying their latest reinforcements, combining mobility and firepower to reshape the battlefield. With fresh deliveries of Bucephalus APC’s, they tighten the noose around a key Russian foothold, setting the stage for a decisive turn in the fight along the Oskil River.

Ukraine aims to eliminate the Russian bridgehead west of the Oskil River and push Russian forces back from Kupiansk, neutralizing the combined threat to the town. Kupiansk serves as a critical logistics hub and a key crossing point supporting Ukraine’s eastern bridgehead, since the 2022 Kharkiv counteroffensive.

After two years of failed frontal assaults, Russia is now using its foothold west of the Oskil to flank Kupiansk and cut off Ukrainian forces in the east. To counter this, Ukraine launched a large-scale encirclement operation, attacking Russians from multiple directions to tighten the noose around their outflanking attempt and eliminate the threat.

To support this operation, the Ukrainian high command reinforced the 14th Mechanized Brigade, veterans of the Kharkiv counteroffensive, with BTR-4E Bucephalus armored personnel carriers, among Ukraine’s best domestically produced armored vehicles.

With a top speed of 110 km per hour, and amphibious capabilities, the BTR-4E is ideal for combat along the Oskil riverbank’s difficult terrain. It enables rapid advances, maneuverability across marshes and muddy terrain, and safe river crossings, ensuring Ukrainian forces can outmaneuver and overwhelm Russian positions.

The BTR-4E is armed with a 30mm autocannon, enabling it to suppress Russian infantry while transporting up to 8 fully equipped soldiers. Its armor protects against small arms fire, grenades, and even RPG’s, making it ideal for assault operations in this sector.

As with the ice on the river melting, Russian forces on the west bank were only able to move infantry across in small rubber boats, meaning they had no access to armor and heavy firepower support. This limited them to light equipment and munitions only, preventing the deployment of heavier anti-tank weapons, leaving them vulnerable to Ukrainian mechanized assaults.

Such difficulties left Russians in no state to resist the oncoming Ukrainian assault, setting the stage for a Ukrainian mechanized assault, with BTR-4 Bucephalus armored vehicles leading the way.

Furthermore, Ukrainian intelligence reports that Russians have only around 500 soldiers along the entirety of the 20 km foothold across the river, amounting to just 25 soldiers per km of the frontline. This allowed the Ukrainian Bucephalus vehicles to drive through the weakest and most vulnerable points of the Russian defenses to dismount their infantry squads.

Subsequently, the Ukrainian fighters used these gaps to go around the main Russian defenses, moving through cover, and then ambushing the Russians from behind, ultimately eliminating them. This allowed the Ukrainian forces to retake several key positions near the settlements of Fyholivka and Zapadne, effectively containing the Russians to a handful of tree lines, while they continued to press on with their assaults.

Furthermore, the Ukrainians also deployed special forces operators directly north of Kupiansk to aid in the counterattacks, clearing enemy hideouts with grenades and gunfire, as well as capturing several prisoners of war. This led to the tightening of the noose around the Russian bridgehead, as Russians lost critical positions to accumulate forces, as well as threatening the weak underbelly of the Russian offensive effort.

Overall, the Ukrainians successfully exploited the weaknesses in the Russian Oskil river bridgehead, utilizing high-quality, domestically produced equipment, with the standout being the BTR-4E Bucephalus armored personnel carriers, providing an effective combination of firepower, protection, and mobility.

Further intensification of the Ukrainian mechanized assaults in this area, against the overstretched Russian positions, will allow them to eliminate the Russian bridgehead for as long as the Russians are unable to reinforce their forces there.

Additionally, as the main Russian supply hub in Svatove is approximately 75 km away from their efforts here, Russians are unlikely to receive the rapid reinforcements they need to stabilize the front and continue their offensive, as Ukrainians will continue to dismantle the Russian effort and push them back into the river.

BTR-4E Bucephalus
https://en.wikipedia.org/wiki/BTR-4

https://www.youtube.com/watch?v=Vln5TSIxtOE


14,214 posted on 03/30/2025 1:22:12 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14210 | View Replies]

To: PIF

“The Finnish-built ones (Icebreakers) need to have”...

Just give them the specs. If it can be done, they can do it.

Finland is the global leader in the design and construction of icebreakers, having developed around 80% of the world’s icebreakers and built around 60%.


14,215 posted on 03/30/2025 1:34:10 PM PDT by BeauBo
[ Post Reply | Private Reply | To 14202 | View Replies]

To: gleeaikin

“Hopefully, sinking of that (Russian) transport (with critical large specialty components for a new Russian icebreaker being built) has given us a little more time to prepare.”

Realistically, if President Trump wants to see new American icebreakers during this term in office, Finland needs to get the contract, out of his first year’s budget.


14,216 posted on 03/30/2025 2:32:44 PM PDT by BeauBo
[ Post Reply | Private Reply | To 14208 | View Replies]

To: BeauBo

Just give them the specs.

Giving them the specs is the problem with building things military - so many people and agencies want to have a hand in it that, whatever they started out to build, becomes an abortion. They still haven’t figured out the specs of the 3 new breakers, even though one may see trials late this year.

In the case of the US built heavy breakers, they started out design-wise as abortions.

Somebody need to steal the design specs of the Russian Project 22220 [ series designation LK-60Ya ] ships. LK-60Ya would have to be capable of breaking at least 2.8-metre (9 ft) ice at continuous speed.

https://en.wikipedia.org/wiki/Project_22220_icebreaker


14,217 posted on 03/30/2025 3:43:14 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14215 | View Replies]

have the Fins match or beat that design.


14,218 posted on 03/30/2025 3:44:24 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 14217 | View Replies]

To: PIF

Over the last week, US military aid flights to Ukraine jumped, with 747 freighters delivering supplies from a number of locations:

2x from McGuire Air Force Base
3x from Joint Base Charleston
1x from Ramstein Air Base
1x from MacDill Air Force Base
1x from Biggs Army Airfield

https://x.com/Osinttechnical/status/1906540738994647278

US GDP blowing up Russian GDP.


14,219 posted on 03/30/2025 9:34:38 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 14218 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, March 30, 2025

US President Donald Trump expressed willingness to introduce additional sanctions targeting Russian oil and secondary sanctions against buyers of Russian oil if Russian President Vladimir Putin does not make progress towards a general ceasefire, including a ceasefire for land warfare in the near future. Trump stated during a phone call with NBC News on March 30 that he is “angry and pissed off” at Putin for disparaging Ukrainian President Volodymyr Zelensky’s legitimacy as the leader of Ukraine.[1] Trump stated that if the United States and Russia are unable to “make a deal” – possibly referring to a general ceasefire or long-term peace in Ukraine – then the United States will place secondary sanctions on all “oil coming out of Russia.” Trump stated that the United States will put a “25 percent tariff on all oil, a 25- to 50-point tariff on all [Russian] oil.” Trump stated that the United States will not allow companies or countries that purchase Russian oil to “do business” in the United States and that the United States could begin imposing secondary sanctions within the next month if Russia, Ukraine, and the United States do not conclude a ceasefire agreement. Trump stated that he will speak with Putin at an unspecified time later this week. Putin reiterated long-standing Russian claims that Zelensky is the illegitimate leader of Ukraine on March 28.[2]

ISW previously noted that the Kremlin’s ongoing effort to characterize the Ukrainian government as an illegitimate negotiating partner casts serious doubt on the Kremlin’s willingness to negotiate in good faith about a settlement of the war and sets informational conditions for Russia to violate any future peace agreement on the grounds that the Ukrainian government had no legal right to conclude it.[3]

A Russian diplomat provided additional details following Russian President Vladimir Putin’s recent thinly veiled demand for regime change in Ukraine by having external parties establish a “temporary international administration” in Ukraine under the auspices of the United Nations (UN). Russian Permanent Representative to the European Union Kirill Logvinov presented a detailed plan to Kremlin newswire TASS on March 30 that supports Putin’s recent demand for the UN, United States, and European countries to establish a temporary government in Ukraine in the near future.[4] Logvinov argued that the UN should reach an agreement between the parties to the conflict following the implementation of a ceasefire, either directly or indirectly through intermediaries, on the appropriate transfer of power to the UN. Logvinov suggested that one of the parties, mediators, or the UN Secretary General should submit an official appeal that the UN establish a temporary internal administration in Ukraine. Logvinov specified that the UN Security Council (UNSC), particularly its permanent members, must support the mandate and that any UNSC member can submit a draft proposal on the composition and funding of the temporary government. Logvinov stated that the UN Secretary General should then prepare a report on the temporary administration, particularly noting staffing and budgetary guidelines, after which the UNSC should consider any proposals and submit a final decision on the interim government. Logvinov noted that the final proposal must also “receive the support of the members of the [UNSC], namely the permanent ones.” Logvinov’s proposal would notably allow Russia (a permanent member of the UNSC) to submit a proposal on the interim Ukrainian government and to veto any proposal that Russia considers unfavorable and would bar Ukraine from any role in the final approval process.

Logvinov and TASS are supporting Putin’s recent effort to inject a new demand into discussions about the resolution to the war that is consistent with the Kremlin’s long-standing effort to ensure the installation of a government friendly to Russia in Ukraine. The Kremlin is also attempting to dictate the sequencing and processes surrounding the demand while holding the ceasefire negotiation hostage to extract additional concessions from the West. UN Secretary General Antonio Guterres rejected Putin’s proposal to establish a temporary administration in Ukraine and stated that Ukraine has a legitimate government that must be respected on March 28.[5]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-30-2025


14,220 posted on 03/31/2025 12:57:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14127 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 14,181-14,20014,201-14,22014,221-14,240 ... 21,341-21,343 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson