Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 13,421-13,44013,441-13,46013,461-13,480 ... 19,481-19,488 next last
Day 1117 of the Russian invasion. 1,400, i.e. more than 50 Russians and Norks/h. Vehicles and fuel tanks more than 175% and artillery more than 65% above average.


13,441 posted on 03/17/2025 12:51:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13418 | View Replies]

To: BeauBo

Генерал СВР 17MAR2025
The team of US President Donald Trump, as well as himself, not only does not have a “peace plan” regarding the war between Russia and Ukraine, but there are not even situational plans to ensure a possible truce between the parties to the conflict. The Russian leadership asked a number of questions to the representative of the American president, which concern both the conditions of the ceasefire itself and monitoring its observance.

Almost a day later, the American side sent all the questions back with a proposal to the Politburo to present their own vision of solving these problems, and to do this urgently, literally by Monday. The Politburo was frankly surprised by this manner of Trump’s team conducting business, but still sent their vision of the situation by Sunday evening. It is highly likely that the next step of the Americans will be to pass this letter unchanged to the Ukrainian leadership, and, probably, try, as they say, to “push through” at least some of the demands from the Russian side. Such ping-pong on Trump’s part is unlikely to lead to a quick solution to all the problems, but he is trying with enviable persistence. Already at this stage, it is absolutely clear that the US President himself and his team do not care about the motives and interests of the parties to the conflict, and they are going to cut the knot of contradictions with the sword of coercion and sanctions. Trump gave his team until April 20, which he warned the Russian leadership about. There is not much time left to wait, although Trump, as quickly as he makes promises, also quickly cancels them, and this certainly does not add seriousness to such an important matter as peace negotiations.

https://t.me/generalsvr/3056

More sources are needed to verify or refute these claims.


13,442 posted on 03/17/2025 1:08:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13439 | View Replies]

To: AdmSmith

Those are good numbers


13,443 posted on 03/17/2025 3:24:25 AM PDT by blitz128
[ Post Reply | Private Reply | To 13441 | View Replies]

To: BeauBo

Why are the Russians so concerned with Moscow international airport(SVO), lol.

The Russians have the capacity to keep feeding the grinder, and putin knows he has no choice as his continued existence depends on it, but the reality of the cost of his dreams cannot be covered up back home forever.

“Strength and resiliency “, reported GDP fly in the fact of extraordinary inflation and interest rates. Neither signs of strength and resilience.

Putin needs a peace deal, but cant accept anything that leaves annexed parts of Ukraine in Ukrainian hands.


13,444 posted on 03/17/2025 3:34:20 AM PDT by blitz128
[ Post Reply | Private Reply | To 13439 | View Replies]

To: FtrPilot

13,445 posted on 03/17/2025 4:48:19 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13444 | View Replies]

To: JonPreston

13,446 posted on 03/17/2025 4:48:49 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13445 | View Replies]

To: JonPreston

13,447 posted on 03/17/2025 4:49:14 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13446 | View Replies]

To: BeauBo

13,448 posted on 03/17/2025 4:49:56 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13447 | View Replies]

To: JonPreston

13,449 posted on 03/17/2025 4:50:23 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13448 | View Replies]

To: JonPreston

13,450 posted on 03/17/2025 4:50:44 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13449 | View Replies]

To: FtrPilot

13,451 posted on 03/17/2025 4:51:14 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13450 | View Replies]

To: All

13,452 posted on 03/17/2025 5:06:21 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13401 | View Replies]

To: BeauBo
Germany has updated its list with supplied aid to Ukraine over the last few weeks.

Delivered:

+24 MRAPs
+ammo for Leopard 1
+ammo for MARDER
+3 GEPARDS
+10.000 GEPARD ammo
+IRIS-T missiles
+5000 155-mm shells
+2000 122-mm shells
+50 VECTOR drones
+30 tracked unmanned ground vehicles Gereon RCS
+30 drone detection systems
+2 WISENT-1 mine clearing tanks
+100 portable mine clearing systems
+2 mine ploughs
+556 laser range finders
+255 infrared binoculars
+2 patrol vehicles
+8000 120-mm mortar ammo
+105 MK-556 rifles
+340 HK-416 rifles
+755.000 first aid kits

https://x.com/NOELreports/status/1901603543422788056


13,453 posted on 03/17/2025 5:21:48 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13452 | View Replies]

To: AdmSmith
At night, Ukraine repelled a large Shahed drone attack. Out of 174 Shahed drones launched, 90 were shot down and another 70 were lost in location, presumably due to electronic warfare.

https://x.com/NOELreports/status/1901537163944108171


13,454 posted on 03/17/2025 5:29:02 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13453 | View Replies]

To: blitz128
A detonation of a Russian ammunition storage located in a village house in the Zaporizhzhia direction.

Judging by the size of the explosion, there was a lot of good stuff there.

📹: Rubak unit of the 65th Mechanized Brigade of the Ukrainian Ground Forces

https://x.com/Gerashchenko_en/status/1901589165919048165


13,455 posted on 03/17/2025 5:31:52 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13454 | View Replies]

To: FtrPilot

13,456 posted on 03/17/2025 5:35:25 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13455 | View Replies]

To: BeauBo
Russian assault group targeted by heavy night bomber drone.

https://x.com/bayraktar_1love/status/1901518521521012987


13,457 posted on 03/17/2025 5:36:58 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13455 | View Replies]

To: All
France will continue to deliver Mirage 2000-5F multirole fighters to Ukraine as it trains new Ukrainian pilots, per French President Macron.

France is also working to accelerate the deliveries of other systems to Ukraine, including drones and missiles.

https://x.com/Osinttechnical/status/1901470441689972954


13,458 posted on 03/17/2025 5:39:11 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13455 | View Replies]

To: FtrPilot
Day 1


13,459 posted on 03/17/2025 5:42:25 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13458 | View Replies]

To: All
🔥🇷🇺 Russian invader gets eliminated by an accurate 🇺🇦 FPV drone strike in the Kharkiv region.

🎯🎯🎯

https://x.com/GloOouD/status/1901538540967624797


13,460 posted on 03/17/2025 5:51:45 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 13458 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 13,421-13,44013,441-13,46013,461-13,480 ... 19,481-19,488 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson