Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,981-13,00013,001-13,02013,021-13,040 ... 19,021-19,027 next last
To: anton
🍈


13,001 posted on 03/08/2025 9:37:18 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12951 | View Replies]

To: BroJoeK; PIF; AdmSmith

I hope you have seen that now, thanks to his anger at Putin’s massive air attacks on Ukraine, Trump is making changes. He is talking about new sanctions affecting Russia’s banking sector.

I also saw reports last night that because Cabinet members are expressing concerns of their business connections, Trump will have Musk make cuts in workforce with a scalpel, not a chainsaw. This makes more sense. I doubt that Musk’s 19 to 24 year old brainiaks have the kind of accounting or investigative expertise to dig out the massive cheating and payoffs that many believe have been happening in govt.


13,002 posted on 03/08/2025 9:57:07 AM PST by gleeaikin (report facts, and their links. Question Authority)
[ Post Reply | Private Reply | To 12966 | View Replies]

To: PIF

A dimwit is also someone who post gibberish just to be annoying, well done
Funny you still didn’t answer the question😂


13,003 posted on 03/08/2025 10:14:45 AM PST by blitz128
[ Post Reply | Private Reply | To 12997 | View Replies]

To: blitz128
Ukrainian drones active in Rostov region. Explosions reported.

https://x.com/NOELreports/status/1898435272418713791


13,004 posted on 03/08/2025 10:16:18 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13003 | View Replies]

To: AdmSmith; BroJoeK; PIF

Trump had already put a halt to shipments to Ukraine of mulitary supplies already in the shipping pipeline. That is why Trump is threatening the Russian banking sector.

Also, according to your comment #12967, Ukraine made a good showing against this latest massive Putin attack. The unusually large numbers added to the right hand column show Ukraine effectiveness against Putin missiles. The 148 killed in the drone category (left column) show that most or all of the Russian drones were killed in that national attack, as well as some in regular combat situations.

Of course Putin/Russia should panic. They are so used to authoritarian decision making, they have no grasp of The Art of the Deal, and thus no understanding of Trump.


13,005 posted on 03/08/2025 10:20:28 AM PST by gleeaikin (report facts, and their links. Question Authority)
[ Post Reply | Private Reply | To 12970 | View Replies]

To: AdmSmith; BeauBo

Not to worry about Patriarch Kirill’s prayer warfare.

We will be protected by all the prayers of our devout Christians who are sure that Trump was divinely birthed by God to save us all through MAGA. Let the “warfare” begin. We will see what God decides, unless Kirill worships a different God which would not surprise me.


13,006 posted on 03/08/2025 10:31:07 AM PST by gleeaikin (report facts, and their links. Question Authority)
[ Post Reply | Private Reply | To 12971 | View Replies]

To: gleeaikin; All
🦅 Map of drones from DroneBomber

https://x.com/Maks_NAFO_FELLA/status/1898439787872182681


13,007 posted on 03/08/2025 10:44:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13006 | View Replies]

Drones attack on Russia 🦅🦅🦅

https://x.com/Maks_NAFO_FELLA/status/1898441152459608518


13,008 posted on 03/08/2025 10:46:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13007 | View Replies]

To: PIF
A Ukrainian MiG-29 crew destroyed a hangar with equipment and a group of Russian troops.

Overnight, APCs and IFVs were moved in, but Ukrainian intelligence took note. At dawn, as the Russians prepared their equipment, Ukrainian aviation delivered a precise strike.

Kursk direction.

https://x.com/wartranslated/status/1898425661175251173


13,009 posted on 03/08/2025 10:48:48 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13008 | View Replies]

To: FtrPilot

Is this the ultimate pro Ukrainian NAFO cope.
Blame the Kursk catastrophe on imaginary North Koreans and at the same time claim these forces are the ones encircled and facing disaster. pic.twitter.com/WekIs8Hx0O— John Bull (@54JohnBull) March 7, 2025


13,010 posted on 03/08/2025 10:52:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13007 | View Replies]

To: PIF
Ukraine is preparing a third strike on the Crimean Bridge – Navy Commander Neizhpapa. The Ukrainian Vice Admiral is optimistic that Ukraine can destroy the Kerch Bridge, writes The Guardian.

There is a saying: ‘God loves a trinity’, he said

https://x.com/NOELreports/status/1898428516183814337


13,011 posted on 03/08/2025 10:55:19 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13009 | View Replies]

To: FtrPilot

13,012 posted on 03/08/2025 10:57:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13011 | View Replies]

To: BeauBo
European countries are ramping up their drone investments.

Thankful to our Allies for standing with us!

▪️The UK will supply $38 million worth of drones produced by US company Anduril in the coming months. The drones will be used to carry out operations in the Black Sea.

▪️Latvia has launched a EUR 10 million initiative to develop automated drone interception technology, electronic warfare and guided anti-drone missiles.

▪️The Netherlands will provide EUR 700 million for drones for Ukraine.

This funding will likely go towards the Ukrainian drone production industry.

Together, we are stronger! 🇺🇦 🇬🇧 🇱🇻 🇳🇱

https://x.com/Gerashchenko_en/status/1898417380927115639


13,013 posted on 03/08/2025 10:59:41 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13011 | View Replies]

To: PIF
Yet another graveyard of destroyed Russian equipment in the Zaporizhzhia direction.

https://x.com/Gerashchenko_en/status/1898397413754249718


13,014 posted on 03/08/2025 11:01:10 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13013 | View Replies]

To: All
trump has ordered the termination of vital support for F-16 jamming equipment that Ukraine has.

What is important to understand is that this could deprive the Ukrainian Air Force of its most important air countermeasures.

https://x.com/NFX360/status/1898352336021413948

Terminating "support" will have minimal impact.

Any NATO country that has F-16AMs can provide the support.

13,015 posted on 03/08/2025 11:07:13 AM PST by FtrPilot
[ Post Reply | Private Reply | To 13014 | View Replies]

To: FtrPilot

Imagine telling yourself in 2016 that the Secretary of Defense under the second (third?) Trump administration has a "Deus Vult" tattoo on his bicep pic.twitter.com/2b3wb9EnOT— captive dreamer (@captivedreamer7) November 13, 2024


13,016 posted on 03/08/2025 11:31:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 13013 | View Replies]

To: FtrPilot; PIF; AdmSmith

Why would they want to destroy the Kerch Bridge now, when recent reports say military and civilians are rapid leaving in quantity. Or maybe just damage it enough so that only autos can drive across and Ork military cannot save large equipment for the future?


13,017 posted on 03/08/2025 11:41:53 AM PST by gleeaikin (report facts, and their links. Question Authority)
[ Post Reply | Private Reply | To 13011 | View Replies]

To: FtrPilot; gleeaikin
🤔 Kursk region. An alleged photo of the gas pipeline through which the Russians wanted to infiltrate Sudzha unnoticed

https://bsky.app/profile/maks23.bsky.social/post/3ljv6vztn7s2q

Most likely, this is an underground pipe of the Urengoy-Pomary-Uzhhorod gas pipeline, which until 1 January 2025 was used by Russia to supply gas to Europe through Ukraine. The diameter of one pipe is 1.4 metres.

https://www.pravda.com.ua/eng/news/2025/03/8/7501875/

13,018 posted on 03/08/2025 12:11:36 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12980 | View Replies]

To: AdmSmith


13,019 posted on 03/08/2025 12:37:04 PM PST by FtrPilot
[ Post Reply | Private Reply | To 13018 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukraine Deploys Fresh Firepower From France! ]

Today [ Mar 08, 8 pm ], there are a lot of important updates from the Bakhmut direction.

Here, with fresh reinforcements and newly supplied French armored vehicles, Ukrainian forces have pushed the Russians back in Chasiv Yar.

As Russian positions were weakened under relentless drone strikes and artillery fire, Ukrainians were able to create fire superiority over the Russians, pushing them back.

The goal of the Ukrainian forces in this area is to maintain control of Chasiv Yar for as long as possible. Chasiv Yar is located on a strategic elevation that overlooks the major Ukrainian stronghold town of Kostiantynivka. This makes Chasiv Yar the most essential part of the Ukrainian defense, as holding the line here would deny Russians a launching point, and fire control for their assaults on Kostiantynivka.

To accomplish this, the Ukrainians are draining Russian resources as effectively as possible, creating weak spots in the Russian lines, and even setting the conditions for localized counter pushes.

Ukrainian forces in Chasiv Yar are supported by several asphalt roads linking them to Kostiantynivka. In contrast, Russian forces lack direct fire control over these routes, ensuring stable and strong logistical support for Ukrainian defensive positions.

Additionally, the clear weather allows for Ukrainians to launch drone swarms to strike Russian forces in their rear and coordinate artillery strikes to do so, as well.

However, Russians have devised a low-tech solution to this glaring problem, placing anti-drone nets around the road from Bakhmut to Chasiv Yar. These nets are supposed to protect Russian logistics against Ukrainian FPV kamikaze drone strikes, as they travel along the main road and into the town, since Russians were trying to move overwhelming numbers into the town to continue their frontal assaults.

Unfortunately for Russians, the Ukrainians fighting in Chasiv Yar decided to make their own weaknesses, as Ukrainian artillery crews would shell certain parts of the road, ripping holes in the netting. This allowed Ukrainian drone operators to move through these gaps and enter the so-called protective tunnel, striking Russian vehicles and soldiers who were driving along the road with a now false sense of security.

Geolocated combat footage from the area reveals how the Ukrainian drone operators successfully targeted and eliminated groups of Russian infantrymen moving to the front.

Additionally, armored vehicles essential for Russian fire support on the platoon level, including BMP-2 infantry fighting vehicles, were knocked out by the kamikaze drones, as well. Even Russian artillery guns like the Nona-S were swiftly detected and destroyed by Ukrainian drone operators.

The result was significant losses in artillery, infantry, and armor, essential for Russians to maintain the pressure in Chasiv Yar. Adding to their difficulties, the recent delivery of French VAB armored personnel carriers to the 24th Separate Mechanized Brigade significantly boosted Ukrainian capabilities. The VAB’s offer superior road mobility, being twice as fast as standard Ukrainian BMP’s and BTR’s while maintaining the same level of armored protection.

Additionally, each VAB can carry 10 fully equipped soldiers, compared to just 7 in most other Ukrainian armored vehicles. This enables rapid transfers of soldiers and equipment from Kostiantynivka to Chasiv Yar, whenever and wherever they are needed most.

The new batch of VAB armored personnel carriers allowed Ukrainians to double their troop flow in Chasiv Yar. On the other hand, Russian forces struggled to counter, due to constant Ukrainian rear strikes and gaps in their drone defense.

This led to Ukrainians establishing fire superiority in the northern part of the city, as Russian sources reported being pushed back several streets at a time and urgently needing new reinforcements.

Overall, while Russians focused on strengthening their logistics, Ukrainians created and exploited their own vulnerabilities in Russian defenses.

The delivery of French armored troop carriers further enhanced Ukrainian capabilities, enabling them to transfer more men and materiel into the town, enforce localized fire superiority, and launch counterattacks, pushing Russian forces back several streets; territory that had taken Russians over 2 months to capture initially.

The expanded Ukrainian foothold in the northern part of Chasiv Yar now allows them to apply further pressure on Russian soldiers here, preventing them from solidifying control and breaking out of the town.


13,020 posted on 03/08/2025 1:07:19 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12994 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,981-13,00013,001-13,02013,021-13,040 ... 19,021-19,027 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson