Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,861-12,88012,881-12,90012,901-12,920 ... 22,461-22,471 next last
To: SpeedyInTexas

So what has changed for these people? He is still building electric vehicles, still working on space program…., but now he doesn’t support ever growing govt, ever growing debt, DEI/woke agenda. Trump was a darling of the dims at one point too.

Has ABC/CNN had on air interviews of their employees who have been laid off? Are only govt employees worthy of this?

It is interesting that the only thing the dims clapped for was Ukraine, but not a 13 year old cancer survivor, young man getting into West Point, family of a rape and murder victim of an illegal.

They will protest cuts in “aid” to other countries, they will protest exposure of fraud and lawfare, interesting priorities

To use one leftists words. It’s disgusting.


12,881 posted on 03/07/2025 3:46:24 AM PST by blitz128
[ Post Reply | Private Reply | To 12880 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, March 6, 2025

Russian President Vladimir Putin and other Kremlin officials explicitly rejected making any concessions in future peace negotiations or accepting any US, European, or Ukrainian peace proposals and the Russian Ministry of Foreign Affairs (MFA) rejected the possibility of a negotiated ceasefire on March 6. Putin stated during a visit to the Defenders of the Fatherland Foundation's Moscow branch on March 6 that Russia does not intend to “give in to anyone” or make any compromises in future peace negotiations.[1] Putin stated that Russia must choose a peace option that best suits Russia and will ensure peace in the long-term. Putin noted that Russian societal unity is critical for Russian victory in Ukraine.[2] Putin alluded to the Russian Revolution, noted that Russian society collapsed during the First World War, and urged Russians to maintain support and unity as the war continues. Putin stated that Russia “will not give up” its “own” territory in future peace negotiations — likely referring to illegally annexed territory in occupied Ukraine.[3] The Kremlin launched the Defenders of the Fatherland State Fund in April 2023 to oversee social support for veterans, elevate veterans within Russian society, and monopolize control over veterans activities in Russia.[4] Putin has also declared 2025 the “Year of the Defender of the Fatherland” — underlining Putin's efforts to prioritize militarizing Russian society and rallying support behind Russia's war effort in Ukraine in 2025.[5]

Russian Foreign Minister Sergei Lavrov claimed during a press conference on March 6 that Russia will reject any proposals to station European peacekeeping forces in Ukraine to enforce a future ceasefire agreement.[6] Lavrov stated that Russia sees “no room for compromise” on this issue and will consider the presence of a European peacekeeping force in Ukraine as akin to a NATO deployment in Ukraine. Lavrov stated that Russia will consider the deployment of any European peacekeepers to Ukraine as the “direct, official, undisguised involvement of NATO countries” in the war and that Russia will reject such a deployment. Russian MFA Spokesperson Maria Zakharova rejected the possibility of a negotiated ceasefire and the deployment of European troops to Ukraine on March 6 and claimed that Russia considers any proposal that gives Ukraine a “respite” along the frontline as unacceptable.[7] Lavrov and Zakharova are explicitly rejecting US Defense Secretary Pete Hegseth’s February 12 suggestion that European and non-European countries should station troops in Ukraine to enforce any future peace agreement.[8]

Lavrov said that any peace agreement must account for the alleged “root causes” of the war in Ukraine, including guarantees that NATO will stop expanding, trying to “swallow” Ukraine, and developing threats against Russia.[9] Lavrov claimed that US President Donald Trump “understands” the need to eliminate these “root causes” while European countries are attempting to ignore the “root causes.” Lavrov previously identified the “root causes” of the war as NATO's alleged violation of obligations not to expand eastward and the Ukrainian government's alleged discrimination against ethnic Russians and Russian language, media, and culture in Ukraine.[10] Russian officials often invoke the concept of “root causes” to allude to their demands for NATO to abandon its open-door policy and to blame the West and Ukraine for Putin's decision to invade Ukraine.

Russian officials will likely take advantage of the suspension of US military aid to and intelligence sharing with Ukraine to spread a longstanding Russian information operation meant to falsely portray Russian victory as inevitable. The Russian Ministry of Defense's (MoD) Main Military-Political Directorate Deputy Head and Akhmat Spetsnaz Commander, Major General Apti Alaudinov, stated on March 6 that Russia should consider conducting a full-scale mobilization, which would build up the Russian military to “at least a couple million [troops].”[11] Alaudinov added that “now is the time” when either “NATO will fall apart” and “[Russia] will destroy Europe” or Europe “can make peace” with Russia and claimed that “it is impossible to defeat Russia on the battlefield.”[12] Alaudinov is likely intensifying the false narrative of Russia's inevitable victory to scare the United States and Europe into making concessions on Ukrainian sovereignty and territorial integrity at a time when the US has already severely limited its support for Ukraine. Alaudinov, who is the Deputy Head of a Russian MoD directorate responsible for disseminating propaganda within the Russian military, is also likely intensifying this false narrative to maximize Russian morale and drive Russian territorial gains while frontline dynamics are increasingly fluid due to the pause in US military aid.

The Kremlin welcomed a Trump administration official's recent comments mischaracterizing Russia's illegal and unprovoked invasion of Ukraine as a “proxy war,” and Russian media portrayed the statement as an admission that the United States is a participant in the war. US Secretary of State Marco Rubio characterized Russia's war in Ukraine as a “proxy war” between the United States and Russia in an interview with Fox News published on March 5.[13] Kremlin Spokesperson Dmitry Peskov stated on March 6 that the Kremlin agrees with Rubio’s characterization of Russia's invasion of Ukraine as a “proxy war.”[14] Russian state and pro-Kremlin media outlets portrayed Rubio as “admitting” that the United States is waging a proxy war against Russia through Ukraine, supporting the false Kremlin narrative and Putin's personal claims that the war in Ukraine is an existential war between the United States and Russia.[15] Kremlin officials, including Putin, Lavrov, and Permanent Russian Representative to the UN Vasily Nebenzya, have consistently used this “proxy war” narrative to justify Russia's invasion of Ukraine since the earliest months of the war in 2022.[16] This narrative aims to falsely portray Ukraine as a puppet state that lacks sovereignty, justify the war to Russian audiences, and discourage US and other Western support for Ukraine by stoking fears of escalation. The Kremlin and Russian state media likely aim to portray the Trump administration as conceding to the Kremlin and its false narrative ahead of future peace negotiations and bilateral talks.

Russian President Vladimir Putin attempted to assuage Russian fears about conscripts going to war amid continued reports that Russian military units are forcing conscripts to sign contracts with the Russian Ministry of Defense (MoD). Putin met with Russian women affiliated with the Defenders of the Fatherland State Fund on March 6 and claimed that Russia does not send conscripts to combat zones.[95] Russian law notably forbids conscripts from directly participating in combat operations.[96] Putin is likely attempting to renew the social contract he made with Russian mothers during the first few months of the war in 2022 following outrage in response to conscripts participating in combat operations.[97] The Russian information space recently raised alarm over reports of Russian military commanders forcing conscripts into combat operations by coercing or faking signatures on MoD military service contracts.[98] Russian conscripts notably defended against the August 2024 Ukrainian incursion into Kursk Oblast despite Putin's pledge to not use conscripts in combat operations, and several conscripts have died in Russia's war in Ukraine despite this pledge.[99] Putin met with hand-picked women who held prominent political positions in November 2022 and falsely framed it as meeting with mothers of mobilized personnel, likely to soothe discontent from relatives of mobilized Russian soldiers in the first few months of partial mobilization.[100] Putin's March 6 meeting likely has similar aims amid continued discontent over the treatment of Russian soldiers, mobilized personnel, and conscripts.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-6-2025

12,882 posted on 03/07/2025 3:54:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12816 | View Replies]


12,883 posted on 03/07/2025 3:56:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12792 | View Replies]

Day 1107 of the Russian invasion. 1,150, i.e. more than 47 Russians and Norks/h. Vehicles and fuel tanks more than 100% above the average.


12,884 posted on 03/07/2025 4:00:48 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12817 | View Replies]

To: marcusmaximus; SpeedyInTexas; PIF; BeauBo; blitz128; ansel12; ETCM; AdmSmith; gleeaikin
Russia attacked Ukraine with a large amount of missiles and drones overnight. The Air Force reports that both F-16's and Mirage-2000 jets were involved in repelling the attack.

Shot down:
25/35 Kh-101/Kh-555 cruise missiles
8/8 Kalibr cruise missiles
0/3 Iskander-M/KN-23 ballistic missiles
0/4 S-300 ballistic missiles
1/8 Kh-59/69 cruise missiles
186/194 Shahed drones (100 shot down, 86 supressed)

https://x.com/NOELreports/status/1897927391135342839


12,885 posted on 03/07/2025 5:18:32 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12879 | View Replies]

To: SpeedyInTexas
Vice President Donald C. Trump talking to President Musk

Your comment is no different than the daily rants from the Trump haters on CNN and MSNBC. People should have known this about you when you wrote two years ago that you supported nuclear war in Ukraine. At least now people can see who you are and who you support. I knew this about you from the start.


12,886 posted on 03/07/2025 5:23:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12875 | View Replies]

To: FtrPilot
European Leadership


12,887 posted on 03/07/2025 5:37:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12885 | View Replies]

To: PIF
It seems like the Russians threw in all the leftover equipment they had gathered for the final push on Chasiv Yar. Over 20 units. The assault was repelled, with 16 vehicles either destroyed or damaged.

https://x.com/wartranslated/status/1897986181733736583


12,888 posted on 03/07/2025 5:40:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12885 | View Replies]

To: SpeedyInTexas; blitz128
🍈

Vice President Donald C. Trump talking to President Musk

These are the NeverTrump Clowns you linked arms with, and now that DJT has exposed Zelensky, this is how they act


12,889 posted on 03/07/2025 5:44:55 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12875 | View Replies]

To: AdmSmith

Russian Offensive Campaign Assessment, March 6, 2025

Russian President Vladimir Putin and other Kremlin officials **explicitly rejected making any concessions in future peace negotiations** or accepting any US, European, or Ukrainian peace proposals and the Russian Ministry of Foreign Affairs (MFA) rejected the possibility of a negotiated ceasefire on March 6.

Putin stated during a visit to the Defenders of the Fatherland Foundation’s Moscow branch on March 6 that Russia does not intend to “give in to anyone” or make any compromises in future peace negotiations.

Putin stated that Russia must choose a peace option that best suits Russia and will ensure peace in the long-term. Putin noted that Russian societal unity is critical for Russian victory in Ukraine.
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-6-2025

Worth posting to all the “peace in Ukraine” threads


12,890 posted on 03/07/2025 5:47:12 AM PST by PIF (They came for me and miProbably worth noting that a Russia friendly governmene ... now its your turn)
[ Post Reply | Private Reply | To 12882 | View Replies]

To: blitz128
🔥 🇺🇦 5th Assault Brigade destroys invaders in the Kurakhove direction, Donetsk region.

x6 -🇷🇺🐷☠️

https://x.com/GloOouD/status/1897897186005766188


12,891 posted on 03/07/2025 5:48:14 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12885 | View Replies]

To: FtrPilot

0/3 Iskander-M/KN-23 ballistic missiles
0/4 S-300 ballistic missiles
1/8 Kh-59/69 cruise missiles


May indicate that UKR Patriot batteries are out of missiles.


12,892 posted on 03/07/2025 5:49:36 AM PST by PIF (They came for me and miProbably worth noting that a Russia friendly governmene ... now its your turn)
[ Post Reply | Private Reply | To 12885 | View Replies]

To: PIF
INFANTRY UPGRADE: @StratcomCentre reports that Ukraine's defense giant Ukroboronprom has increased production of Bren 2 assault rifles to 400 units per day. These modern, accurate rifles will replace aging RU based AK pattern weapons in wide use in UKR units.

https://x.com/ChuckPfarrer/status/1898001121878434258


12,893 posted on 03/07/2025 5:52:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12891 | View Replies]

To: FtrPilot
Operation EU Clown Face


12,894 posted on 03/07/2025 5:52:56 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12891 | View Replies]

To: FtrPilot
Send in the Clowns


12,895 posted on 03/07/2025 5:54:49 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12891 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Troops Charge on Horseback in a Disaster! ]

Today [ Mar 06, 8 pm ], there is important news from the Pokrovsk direction.

Here, desperate Russian commanders attempted to achieve a breakthrough at any cost.

With Ukrainians creating a kill zone for vehicles, Russians started deploying horses, reimplementing cavalry into modern warfare.

South of Pokrovsk, Russian forces are desperate to push westward, attempting to put as much distance as possible between their rear positions and the relentless Ukrainian drone operators targeting their rear. Their constant drone strikes are devastating Russian supply lines, command centers, and units moving to the contact line, severely disrupting an already weak logistical network.

To counter this, the Russians aimed to seize control of the small settlements scattered across the vast open fields in the area, which would serve as launching points for further assaults westward, while denying the Ukrainians the ability to do the same in the other direction.

While frozen ground conditions technically allow Russian forces to maneuver their remaining armored vehicles more effectively, their ability to conduct large-scale mechanized assaults has been severely weakened by the staggering number of vehicle losses sustained over months of fighting.

Despite the solid terrain, the battlefield dynamics remain under Ukrainian drone dominance. Russian forces have found it nearly impossible to advance without being spotted, and any attempt at rapid movement results in swift targeting by Ukrainian artillery and drones.

The regular Russian tactic of using the survivors of failed mechanized assaults to dig in along tree lines does not work with completely frozen ground, as it is too hard to dig in quickly enough before Ukrainians fully eliminate them with drones.

Russian assault groups that manage to cross open terrain are often left exposed without cover and subsequently eliminated by Ukrainian drone strikes. With few alternatives, the Russian advance has been restricted mainly to the settlements in the fields, relying on spread-out buildings for cover.

Several geolocated videos show the work of Ukrainian troops in dismantling the rarely available Russian vehicles. A Russian T-72B3M tank can be seen delivering soldiers to a position in a tree line, but at that very moment, 2 Ukrainian FPV drones can be seen already flying towards it, striking it precisely and destroying it on the spot.

Another video shows how Ukrainian kamikaze drones are hunting and eliminating Russian soldiers, ATVs, armored personnel carriers, more tanks, and military trucks filled with soldiers and supplies.

A stark indication of Russian struggles has emerged in recent footage from Russian soldiers filming themselves moving to the frontline on horseback. They are seen carrying their full combat equipment, including armor vests and shoulder-fired anti-tank weapons.

Another clip shows other soldiers riding horses through a village, again moving toward the front, however, with fewer weapons than the previous group. This shows that the implementation of new improvised cavalry units applies to all levels of the Russian armed forces, from highly trained personnel to the foot soldiers sent on meat waves.

Other shocking images even show the usage of donkeys and a camel to transport supplies. While these methods may partially help sustain some positions, it highlights the growing desperation, as the use of such improvised cavalry in modern warfare is an unmistakable sign that conventional Russian logistics have entirely broken down.

Meanwhile, Ukrainian mechanized units continue to operate effectively, reinforcing positions, rotating troops, and maintaining steady pressure on Russian-held settlements. Footage shows how 2 Russian fiber-optic-guided drones attacked a Ukrainian Kozak-2M1 armored vehicle but were unable to detonate, leaving the crew unharmed.

Another video shows how two Ukrainian tanks destroyed a building in the village Sribne, where up to 10 Russians were attempting to establish a foothold. In another, a Ukrainian Bradley armored fighting vehicle successfully evacuated Ukrainian soldiers who were pinned down by opening suppressive fire and deploying a smoke screen.

Overall, the ongoing battle near Pokrovsk illustrates the widening gap in military capabilities between the 2 sides. While Ukrainian forces maintain mobility with modern mechanized forces, Russian troops are being pushed into increasingly outdated and desperate tactics, relying more and more on animals to sustain their operations.

If this trend continues, Russian attempts to advance westward will remain slow, costly, and ultimately unsustainable, while Ukrainian defenders continue to tighten their hold on the battlefield, and winning the war of attrition.


12,896 posted on 03/07/2025 6:00:01 AM PST by PIF (They came for me and miProbably worth noting that a Russia friendly governmene ... now its your turn)
[ Post Reply | Private Reply | To 12888 | View Replies]

To: PIF

Here's Jeffrey Sachs testifying that right after the 2014 overthrow of Ukraine's democratically elected government, he was personally flown to Kiev and told as he was walked around the Maidan Square "how the US paid all the money" for the protesters who overthrew the government

pic.twitter.com/LOqiOV6UIj— Mike Benz (@MikeBenzCyber) March 6, 2025


12,897 posted on 03/07/2025 6:00:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12896 | View Replies]

To: JonPreston


12,898 posted on 03/07/2025 6:02:08 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12897 | View Replies]

To: PIF
"May indicate that UKR Patriot batteries are out of missiles."

Possibly...for the Patriot to be effective against ballistic missiles, the ballistic missile's target must be located within 40NM of the Patriot launcher.

It's possible that ruzzia figured this out and launch their ballistic missiles against targets away from Patriot sites.

This also shows that fighter aircraft do not have capability against ballistic missiles...they are very effective against shahed drones & cruise missiles.

I cannot figure out why 1/8 Kh-59/69 cruise missiles were shot down.

12,899 posted on 03/07/2025 6:02:45 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12892 | View Replies]

To: JonPreston

12,900 posted on 03/07/2025 6:02:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12898 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,861-12,88012,881-12,90012,901-12,920 ... 22,461-22,471 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson