Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,801-12,82012,821-12,84012,841-12,860 ... 19,061-19,068 next last
To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Hundreds of Russians Retreat Running From Pokrovsk! ]

Today [ Mar 05, 8 pm ], there are interesting updates from the Pokrovsk direction.

Here, Ukrainian troops continued their counterattacks and launched another raid against Russian positions along the railway near Kotlyne, outflanking the Russians in a perfectly executed maneuver.

With Ukrainians taking the only Russian attack route under complete fire control, the Russians’ hope of taking Udachne is now potentially lost forever.

Ukrainian forces are capitalizing on their recent successes in the Pokrovsk sector, seeking to push Russian troops further away from the town. Over the past few weeks, Ukrainian counterattacks have proven highly effective, demonstrating their ability to identify and exploit weak points in Russian lines, and execute precise and well-organized operations to accomplish this.

Ukrainians are now seizing the opportunity to launch another offensive maneuver southwest of Pokrovsk, targeting Russian positions near Udachne to disrupt enemy advances, and secure critical defensive terrain.

The Ukrainian defense in Udachne is well-connected to the central Ukrainian supply lines, with a side road leading to the Pokrovsk-Dnipro highway, and a direct supply route to Mezhova, a larger settlement that facilitates rapid troop rotation and resupply.

Unlike the Russians, who struggle to transport reinforcements due to Ukrainian drone threats, Ukrainians can quickly move troops and supplies, reinforcing their positions with minimal delay.

Russian forces in the Pokrovsk area face serious challenges: a lack of manpower, overstretched supply lines, and difficulties maintaining fortified positions. Their inability to consolidate their gains has left them vulnerable to the Ukrainian counterattacks we have seen increasingly intensifying.

Reports indicate that Russian units can often only deploy 1 or 2 soldiers at a time to seize or reinforce positions, a sign not only of extreme resource strain, but also of overwhelming Ukrainian drone superiority at Pokrovsk.

Due to the high aerial threat from Ukrainian drones, Russian troops cannot use armored vehicles close to the contact line, and sometimes must walk up to 10 kilometers on foot to reach their positions, further exhausting them before they even engage in combat.

Meanwhile, Ukraine has demonstrated its ability to mount effective counterattacks by integrating drone and artillery support with ground operations, a combination that has led to devastating Russian losses. The superior coordination of these systems is making Russian advances increasingly costly, as every movement is closely monitored and targeted with precision strikes.

Despite attempts to use frozen terrain to deploy heavy equipment, Russian forces are struggling to consolidate gains, and analysts note that Ukrainian electronic warfare systems are now starting to interfere with Russian glide bomb navigation, limiting the strongest Russian implementation for their air support.

Ukrainians identified a key weak spot in the Russian defenses: a trench network within a tree line south of Udachne, which extended toward the railway, and had been used by Russian forces to launch their assaults from, and guard their ground lines of communication. Geolocated footage from a surveillance drone shows how Ukrainians monitored the position, allowing them to detect and target the precise dugouts Russians were in with FPV drones.

Hereafter, Ukrainian soldiers in white winter camouflage carefully cleared the trenches with grenades and small arms fire. As Ukrainians then quickly reinforced the area and started projecting their own fire control, Russian soldiers realized they had been outflanked and withdrew from the railway line en masse.

By targeting and recapturing these trenches, Ukrainian forces have removed a critical launching point for Russian attacks, and positioned themselves to deny further Russian movement in this direction. The well-prepared defensive structures now serve as Ukrainian strongholds and give them fire control over Russian attack routes into Udachne, making it nearly impossible for enemy forces to reestablish a foothold in the area.

With Ukrainians maintaining strong fire control over the Russian approaches with drones, they can still only muster small infantry assault groups, making it unlikely that Russians will be able to retake this stronghold any time soon.

Overall, with Russian forces pressured to withdraw from the railway, Ukrainians now have a good opportunity to clear out more enemy positions on the western flank of Pokrovsk.

By continuing to exploit Russian weaknesses, Ukrainian forces could push their lines even further, ensuring that Russian assaults on Pokrovsk become increasingly difficult.


12,821 posted on 03/06/2025 6:24:47 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12814 | View Replies]

Since the beginning of 2025, many residents of Russia have faced real robbery: they began to receive electricity bills in which the amount of payment has increased two or three times. Crazy payments have already become the reason for citizens to appeal to President Vladimir Putin and the heads of regions. It turned out that the new tariffs were introduced without much publicity on January 1 for the sake of... fighting [crypto] miners. However, the blow fell on ordinary people, including large families and the disabled. People's discontent has already led to public appeals to the head of state. And a reaction must follow, otherwise there will be a social explosion.

In Karelia, people are faced with a choice - either freeze or take out loans to pay for electricity. The alarm is being sounded in the Khanty-Mansi Autonomous Okrug, where they consider bills of over 50 thousand rubles to be simply a mockery. In the Lipetsk Region, residents are calling the situation a horror, and in Udmurtia, people are also simply clutching their heads. A similar situation is in the Yamalo-Nenets Autonomous Okrug, in the Krasnodar Territory, and the Irkutsk Region. The Moscow Region is no exception, where the owner of a 90 sq. m. house paid 23 thousand rubles for energy instead of the usual 10 thousand, although she does not live in a country house in winter, but simply keeps it warm.
https://dzen.ru/a/Z8OEztvCNz7DhK3n

12,822 posted on 03/06/2025 6:25:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12820 | View Replies]

StarShip Flight 8 relaunch 5:30 pm CT today


12,823 posted on 03/06/2025 6:26:26 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12821 | View Replies]

To: PIF
UKRAINE'S ARSENAL OF DEMOCRACY: By 2025, Ukraine will manufacture one-third of the weapons needed for its defense, with a goal to reach 50% in the coming years. With Washington unpredictable, Ukraine’s future and strength lies with global defense partnerships.

https://x.com/ChuckPfarrer/status/1897407150055678114


12,824 posted on 03/06/2025 6:45:33 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12823 | View Replies]

To: PIF

BREAKING:

Trump to deport Ukrainian refugees

Trump administration plans to revoke legal status for 240.000 Ukrainiana who fled to US - Reuters

pic.twitter.com/fqJFQECUBQ— Megatron (@Megatron_ron) March 6, 2025


12,825 posted on 03/06/2025 6:53:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12821 | View Replies]

To: AdmSmith; SpeedyInTexas
God bless Elon


12,826 posted on 03/06/2025 6:56:01 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12822 | View Replies]

To: PIF
Russia launched missiles and drones overnight. Out of 122 Shaheds launched, 68 were shot down and 43 were supressed by electronic warfare. Also two Iskander-M/KN-23 ballistic missiles were launched. The results of repelling these was not communicated.

https://x.com/NOELreports/status/1897561619183345747


12,827 posted on 03/06/2025 7:01:34 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12824 | View Replies]

To: All
Russian FM Lavrov says Moscow will not "compromise" on the potential deployment of European peacekeepers in Ukraine as a prerequisite for peace.

More than that, Lavrov reveals Russia's hand here: "If you put troops in a territory, you probably don't want to negotiate any conditions, because you're creating facts on the ground."

I've said it before and I'll say it again. Russia is lying about having any intentions to negotiate. Russia is not really interested in peace - Lavrov confirms as much here.

They are playing for time, delaying the negotiations, to keep the war going.

https://x.com/Gerashchenko_en/status/1897598606158266429


12,828 posted on 03/06/2025 7:11:40 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12827 | View Replies]

To: FtrPilot

“If you put troops in a territory, you probably don’t want to negotiate any conditions, because you’re creating facts on the ground.”


If that’s true, it goes for Russia as well, betraying their intention to keep fighting.


12,829 posted on 03/06/2025 7:15:33 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12828 | View Replies]

To: AdmSmith
France and the UK will keep providing intelligence to Ukraine to fill the gap left by US.

France is offering intelligence to Ukraine, French defence minister Sebastien Lecornu said on Thursday.

"We have intelligence resources that we use to help the Ukrainians," Lecornu told radio station France Inter.

"It has been suspended since yesterday afternoon," he added, referring to U.S. intelligence-sharing with Ukraine. "I think for our British friends who are in an intelligence community with the United States, it is more complicated."

According to Politico, the British are also prepared to fill the gap, in particular through their aerial electronic surveillance, but their intelligence capabilities cannot match those of the Americans.

📸RAF

https://x.com/Gerashchenko_en/status/1897570172665294914


12,830 posted on 03/06/2025 7:21:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12828 | View Replies]

To: PIF
IMHO, ruzzia is trying to get President Trump to cut off all U.S.aid to Ukraine and to ease all U.S. sanctions on ruzzia.

They believe that the E.U. doesn't have the resources or the will to provide the resources necessary for Ukraine to win the war.

12,831 posted on 03/06/2025 7:28:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12829 | View Replies]

To: FtrPilot

12,832 posted on 03/06/2025 7:37:32 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12827 | View Replies]

To: blitz128
Ukrainian forces are retaking more and more villages around Pokrovsk. Russian channels report of problems in manpower and Russian glide bombs being jammed.

Together with reports coming from Toretsk, Chasiv Yar and Kupyansk, where Ukrainian forces are gradually pushing back Russian troops, this seems to be not a local outlier, but a general development.

https://x.com/Tendar/status/1897663041589690831

Pokrovsk on Google Maps

12,833 posted on 03/06/2025 7:41:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12831 | View Replies]

To: MalPearce

12,834 posted on 03/06/2025 7:42:10 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12809 | View Replies]

To: PIF
Russian airborne troops are returning home.

https://x.com/wartranslated/status/1897636664907817469


12,835 posted on 03/06/2025 7:49:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12833 | View Replies]

To: PIF
While Trump is saving Putin, the latter is facing problems on the front lines—AFU are counterattacking in several locations across Donbas, including Pokrovsk, Chasiv Yar, and Toretsk.

The Russians report serious issues with manpower, depleted by Gerasimov’s endless meat assaults. Of course, there’s no need to rush to conclusions—the AFU’s advances are localised, and there’s no guarantee they won’t be halted at some point.

Below, you can read devastating report from a Russian source to better understand the situation.

https://x.com/wartranslated/status/1897574309998051432


12,836 posted on 03/06/2025 7:54:28 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12835 | View Replies]

To: FtrPilot

IMHO, ruzzia is trying to get President Trump to cut off all U.S.aid to Ukraine and to ease all U.S. sanctions on ruzzia.

Ditto. And hand Russia a victory. There is no truth to the rumor that 47 will be attending the May 9th victory cerebration on Red Square.


12,837 posted on 03/06/2025 7:55:46 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12831 | View Replies]

To: FtrPilot

3 rows stacked 2 high, but how many to a row is blurred. Traveling steerage class.


12,838 posted on 03/06/2025 8:00:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12835 | View Replies]

To: BeauBo
🇷🇺 Russia says Macron is "detached from reality" after his nuclear comments.

FM spokeswoman Zakharova mocked the French President, calling him a "storyteller" after he labeled Russia a threat to Europe and suggested extending France’s nuclear protection to allies, RIA reports.

https://x.com/NOELreports/status/1897568745607860522


12,839 posted on 03/06/2025 8:43:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12838 | View Replies]

To: BeauBo; All
It is about damn time - President of the European Parliament Roberta Metsola on the need to scale up Europe's defense capabilities.

"The situation today is exactly the same as it was three years ago - Ukraine is fighting for Europe, and Europe needs to be hand-in-hand, lock-step with whoever is fighting for our security and values.

Ukraine's security is Europe's security," @EP_President said.

https://x.com/Gerashchenko_en/status/1897689134115749959

...on the need to scale up Europe's defense capabilities.

This is exactly what President Trump was trying to accomplish from 2017 to 2020.

pootin did that.

12,840 posted on 03/06/2025 9:04:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12839 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,801-12,82012,821-12,84012,841-12,860 ... 19,061-19,068 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson