Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,581-12,60012,601-12,62012,621-12,640 ... 22,481-22,496 next last
To: dimwit
🍈


12,601 posted on 02/27/2025 3:26:40 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12600 | View Replies]

To: BeauBo

Danke😂


12,602 posted on 02/27/2025 3:56:31 PM PST by blitz128
[ Post Reply | Private Reply | To 12595 | View Replies]

To: blitz128

Poor 🍈
Which is it Trump is gonna end this and save America or is he now the enemy. Some tough times for you, repeating memes, thinking people care what you say or do, confusing Kremlin talking points 😂


12,603 posted on 02/27/2025 3:59:05 PM PST by blitz128
[ Post Reply | Private Reply | To 12602 | View Replies]

To: blitz128
🍈


12,604 posted on 02/27/2025 7:02:21 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12603 | View Replies]

To: blitz128

“President Trump has prolonged sanctions against the Russian Federation for one more year”

Sanctions continue to work.

Kyiv Independent reports:

“Turkish imports of Russian oil have quietly plummeted since harsher sanctions were imposed earlier this year, the Moscow Times reported on Feb. 27.

The U.S. and U.K. passed sweeping sanctions against Russia’s oil sector on Jan. 10, particularly targeting Moscow’s “shadow fleet” of tankers.

Shipments of Russian Urals, the country’s flagship crude oil, have dropped to a low not seen since December 2022. Turkish imports of Russian Urals fell to 0.24 million tons in February, down from 1.56 million tons in January, the Moscow Times reported.

Turkey’s top refiner, Turkiye Petrol Rafinerileri (Tupras), has stopped accepting shipments of Russian crude, demanding that they comply with the $60 per barrel G7 price cap, Reuters reported earler this month. The change in policy began after the Jan. 10 sanctions.

The drop in Turkish demand for Russian oil has impacted operations at Gazprom Neft and Surgutneftegaz, major Russian oil and gas companies, and has affected over 180 tankers of the so-called “shadow fleet,” a large group of vessels Russia uses to circumvent Western sanctions.

Amid sanctions on Russian oil, Turkey has sought to import from other producers. Turkish imports of oil from Africa reached a five-year high in February.”


12,605 posted on 02/27/2025 8:09:54 PM PST by BeauBo ( )
[ Post Reply | Private Reply | To 12584 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 27, 2025

Kremlin guidelines to Russian state media about coverage of recent US–Russian meetings indicate Russian President Vladimir Putin's determination to manipulate US President Donald Trump and divide the West. Russian opposition outlet Verstka reported on February 27 that sources in Russian state media who are close to the Russian presidential administration stated that the Kremlin has not given “strict” instructions to media about how to cover recent US–Russian contacts.[10] A source who regularly participates in Kremlin meetings with major media editors reportedly stated that the Kremlin told media outlets to emphasize “in every way” that Russia is in contact “not with some abstract Americans, but with Trump's team” and to demonstrate that Trump is “a man who was oppressed in every way both at home and in Europe.” Multiple sources reportedly told Verstka that they had received instructions to create an image of Trump as a man who “had the wisdom” to respond to the Kremlin's “outstretched” hand. Putin praised the Trump administration on February 27, claiming that Russia's first contacts with the administration “inspire certain hopes” and that the Trump team is displaying a “reciprocal determination” to restore US–Russian relations.[11] Putin claimed that “ideological cliches” have started to “destroy the Western community ... from within,” as evidenced by alleged problems in Western states’ economies and domestic politics. Putin claimed that “some Western elites” are trying to “maintain instability” in the world and will try to “disrupt or compromise” the US–Russian dialogue that has begun. Putin's claim that “some Western elites” — but not the Trump administration — are against US–Russian talks is likely an attempt to drive wedges between Trump and other US actors and European leaders. The Kremlin has similarly recently framed European leaders as interested in prolonging the war in Ukraine as part of efforts to falsely portray the US and European positions on negotiations as significantly different and to discredit any possible European role in negotiations.[12]

The Kremlin is reportedly continuing to push the United States to accept economic benefits that are unrelated to the war in Ukraine in return for Ukrainian and Western concessions that are related to the war. Bloomberg, citing a source familiar with the topic, reported on February 27 that CEO of the Russian Direct Investment Fund (RDIF) and newly appointed Special Presidential Representative for Investment and Economic Cooperation with Foreign Countries Kirill Dmitriev — who was part of the Russian delegation during the February 18 US–Russian talks in Saudi Arabia — convinced Putin to seek negotiations with the United States through business opportunities.[21] The Kremlin reportedly viewed US President Donald Trump's interest in a mineral deal with Ukraine as a chance to initiate economic cooperation discussions between the United States and Russia, giving Dmitriev an opportunity to take the lead on such initiatives.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-27-2025

12,606 posted on 02/28/2025 3:55:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12526 | View Replies]


12,607 posted on 02/28/2025 3:57:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12468 | View Replies]

To: blitz128

🍈 ouch 😂


12,608 posted on 02/28/2025 4:03:46 AM PST by blitz128
[ Post Reply | Private Reply | To 12603 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

—

[ Putin Wants to Negotiate! Ukrainians Are Holding Kursk! ]

Today [ Feb 27, 8 pm ], there are important updates from the Kursk direction.

Here, the Russians threw themselves forward in a desperate attempt to break the Ukrainian defense in the Kursk salient.

However, Ukrainians launched a devastating air strike on the main Russian forward operating base, cutting the head off the snake and scattering the Russian efforts, bombing the remaining infantry till none were left to continue the assaults.

For months, Russian forces have been trying to retake all lost territories in the Kursk region, aiming not just to erase Ukraine’s recent gains, but to push them back across the border completely. Their goal is clear: they cannot afford to continue to have a sizable portion of Russian land controlled by Ukraine.

The Ukrainian-held territories in Kursk are not just a battlefield, but a bargaining chip in future peace negotiations. As long as Ukrainian forces remain in Russia, even on a relatively small scale, Ukraine holds a psychological and diplomatic advantage.

The longer this situation drags on, the more damaging it becomes for Russian political and military leadership, which cannot convincingly claim military dominance while Ukrainian troops hold ground inside Russian borders.

To rectify this, Russian forces have launched repeated large-scale assaults all over the Kursk salient, attempting to overwhelm Ukrainian positions with sheer numbers. However, most of these attacks fail before making any meaningful gains. Even when Russian forces do manage to capture ground, it is often minimal and against heavy casualties.

As part of their renewed offensive efforts, Russian forces have begun fierce battles to retake areas lost in Ukraine’s recent counterattacks near Cherkasskaya Konopelka.

One of the few advantages Russia has in this sector is that Ukrainian were never able to fully consolidate control over the forests leading up to Ulanok. Russian forces are using this large grey zone to infiltrate the forests and attack Ukrainian positions in small groups, attempting to take advantage of any gaps in the line and collapse the Ukrainian defense bit by bit.

Despite these attempts, the relatively clear weather has allowed Ukraine to maintain constant drone surveillance, making Russian movements predictable and easy to counter.

Second, the frozen winter ground complicates Russian efforts to dig new positions closer to Ukrainian lines, shrink the large grey zone, and advance their area of control. Without these proper fortifications, Russian assault groups remain highly vulnerable to Ukrainian drone strikes and artillery.

Ukrainians capitalized on these weaknesses, launching devastating attacks from the air against Russian troops attempting to advance, with Ukrainian Vampire and Baba Yaga drones constantly hunting enemy forces with various drone-dropped munitions. One recent drone operation detected 4 Russian soldiers moving toward cover inside a building.

However, before they could secure a safe position, a Vampire hexacopter struck, dropping a TM-62 anti-tank mine on their hideout. The powerful explosion obliterated the building and everyone inside, cutting off another Russian assault attempt, before it could even begin.

In another highly successful operation, Ukrainian reconnaissance drones geolocated a Russian forward operating base, tracking troop movements and vehicles as they prepared for a more coordinated assault.

Using this intelligence, Ukraine launched a missile strike, targeting the command post directly with several cluster munitions. The missile strike inflicted heavy losses, throwing Russian assault plans into disarray, loosing coordination and leaving them to only launch disorganized small infantry group assaults instead.

To compensate for such heavy losses, the Institute for the Study of War reports that Russian forces have resorted to a desperate measure, moving soldiers wounded in battles in eastern Ukraine to Kursk under the pretense of “treatment and rehabilitation.”

However, on arrival, these soldiers are instead given weapons and sent to active combat operations on the front line, reflecting the desperation Russian forces feel to push Ukrainians out of Kursk before it can be used as diplomatic leverage.

Overall, despite constant Russian assaults and intense artillery barrages, Ukrainian forces still hold a significant amount of ground in Kursk. While Russians have retaken large parts, the deeper Russian forces push, the stronger Ukraine’s defenses become.

The current Ukrainian positions have withstood months of attacks, and with Russia’s declining assault capabilities, dwindling reserves, and constantly disrupted command structure, it is clear that their goal of retaking the Kursk salient is slipping further out of reach.


12,609 posted on 02/28/2025 4:04:47 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12607 | View Replies]

Day 1100 of the Russian invasion. 1,060 i.e. more than 44 Russians and Norks/h. Vehicles and fuel tanks more than 255% and artillery more than 140% above the average.


12,610 posted on 02/28/2025 4:06:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12528 | View Replies]

To: AdmSmith

Happy anniversary

https://m.youtube.com/watch?v=knp9-GY6fHE


12,611 posted on 02/28/2025 4:08:16 AM PST by Z28.310 (does not comply well with others)
[ Post Reply | Private Reply | To 12610 | View Replies]

To: PIF
A soldier from Russia's 26th Motorized Rifle Regiment whined that drones and artillery slashed his 125-man unit to 40. Great staff optimization!
https://bsky.app/profile/wartranslated.bsky.social/post/3ljacrrnkns2o

40 sec video

12,612 posted on 02/28/2025 4:51:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12609 | View Replies]

Fighting alcoholism in the Russian army: a commander locked his drunk soldiers in a basement for two days without food or water, forcing them to relieve themselves on the spot. Discipline, Russian style.

https://bsky.app/profile/wartranslated.bsky.social/post/3ljaglm4c3s2o

1 min video


12,613 posted on 02/28/2025 4:54:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12612 | View Replies]

To: Dopey
🍈

g'morning Dopey


12,614 posted on 02/28/2025 4:57:39 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12608 | View Replies]

To: blitz128

❗️On the night of February 28, the Ukrainian Defense Forces destroyed a warehouse storing thermobaric ammunition of the 🇷🇺Russian military in the temporarily occupied territory of the Donetsk region, in the Selidove district. - General Staff of Ukraine

https://bsky.app/profile/militarynewsua.bsky.social/post/3ljack3edgs24
In addition, three more important facilities of the Russian troops were hit. In particular, the Ilsk Oil Refinery (Krasnodar Krai, RF), which is involved in providing supplies to the Russian occupation army. The results of the hit are being clarified.

30 sec video


12,615 posted on 02/28/2025 4:58:02 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12608 | View Replies]

To: blitz128

Thank you 🍈, good evening to you


12,616 posted on 02/28/2025 5:57:36 AM PST by blitz128
[ Post Reply | Private Reply | To 12608 | View Replies]

To: blitz128; PIF; Dopey
🍈


12,617 posted on 02/28/2025 6:23:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12616 | View Replies]

To: PIF

Poor🍈, firing memes again, sign of a “super genius”

Kremlin has left him rudderless 😂


12,618 posted on 02/28/2025 6:31:11 AM PST by blitz128
[ Post Reply | Private Reply | To 12609 | View Replies]

To: blitz128; PIF; dimwit
🍈


12,619 posted on 02/28/2025 6:52:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12618 | View Replies]

To: blitz128
Despite the reshuffling in the Russian leadership, key positions remain unchanged. The role of former Defense Minister Sergei Shoigu has significantly diminished, while Nikolai Patrushev continues to maintain influence, according to the Head of the Defense Intelligence of Ukraine, Kyrylo Budanov.

Asked about who currently influences Russian President Vladimir Putin the most and whether the political situation in Russia has changed significantly Budanov replied, “Nothing has changed. The only thing is that Shoigu’s role has greatly decreased. At the same time, Patrushev’s position has remained almost unchanged.” He emphasized that the position of Secretary of the Russian Security Council remains key in Russian power, but Shoigu has been limited in influence. Budanov also pointed out that Putin's assistant, Nikolai Patrushev’s office, is located directly in the Kremlin, which underscores his status.

“Shoigu did not become Patrushev. He can't even appoint his deputies. He works fine, but only as a technocrat handling bureaucratic and organizational issues,” Budanov summarized.
https://newsukraine.rbc.ua/news/ireland-to-advocate-for-ukraine-s-accelerated-1740678096.html

12,620 posted on 02/28/2025 7:37:42 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12618 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,581-12,60012,601-12,62012,621-12,640 ... 22,481-22,496 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson