Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,481-12,50012,501-12,52012,521-12,540 ... 22,501-22,520 next last
To: dimwit
🍈


12,501 posted on 02/26/2025 5:25:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12500 | View Replies]

To: gleeaikin

some of them are still in territory occupied by Russia is yet to be worked out.

Correction:
Most are under Russian control: 70-80%


12,502 posted on 02/26/2025 5:32:45 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12484 | View Replies]

To: BeauBo

“I’d like to buy minerals on Russian land too if we can,” he said.

“The rare earth, they have very good rare earth ... It’s great for Russia too, because we could do deals there. They have very valuable land that isn’t utilized, so something like that could take place.”


Great idea - let’s give Russia some hard currency so they can rearm quicker and better!!


12,503 posted on 02/26/2025 5:35:30 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12489 | View Replies]

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians Caught in Cluster Carnage! ]

Today [ Feb 25, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, as Ukrainians have ensured that any Russian operations to resupply the besieged North Koreans would end in complete failure, Russians launched a multi-vectored assault, hoping to break the North Koreans out instead.

However, as Russians moved into position under the cover of darkness, Ukrainians unleashed a rain of cluster munitions, ensuring that it would be a night Russians would never forget.

The new goal of the Russian forces in this area was to try and link up with North Korean forces stuck in Nikolske to break them out. The previous attempts to resupply them had failed, and the North Koreans were running out of supplies more and more with each passing day, forcing Russians to attempt to lift the siege instead.

To achieve this, Russian forces prepared a two-pronged assault on Viktorovka. A southern infiltration force would strike at night to surprise Ukrainian defenders and engage them in close-quarters combat. By day, a mechanized assault from the north would provide fire support to the infantry.

Capturing Viktorovka would help reestablish secure supply lines with allies in Nikolske and potentially set the stage for future assaults on Ukraine’s main defensive line behind the Loknya River.

On the southern axis, Russian forces would infiltrate through interconnected tree lines with infantry, concealing their movement from Ukrainian observation at night. These tree lines led directly to settlements west of the river, allowing Russian troops to launch surprise attacks.

Meanwhile, the northern pincer, composed of mechanized units, moved along forest edges to avoid detection. The Russian strategy hoped that the initial nightly infiltration assault would divert Ukrainian attention enough for the armor to reinforce them during the day, while also using the forest’s cover to shield against Ukrainian ATGMs.

However, the Russian plan quickly unraveled. On the southern flank, Ukrainian drone operators used thermal cameras to detect soldiers moving through the tree lines at night, negating their concealment. On the northern flank, Ukrainian drones maintained constant reconnaissance near Kruglenkoe, regardless of any battles in the settlements, quickly spotting Russian vehicles moving along the forest’s edge.

Additionally, a shortage of reserves forced Russians to incorporate North Korean soldiers into the assault, undermining their cohesion due to the language barrier.

Geolocated combat footage from the southern attack vector reveals how the Russian and North Korean forces were detected with thermal cameras as soon as they started moving through the tree line.

Ukrainians quickly relayed the coordinates to artillery crews, waiting till the Russians entered a less-dense part of the tree line where there was less cover to shield them, before unleashing a devastating artillery barrage with cluster munitions, completely eradicating the Russian surprise infiltration assault in seconds.

Despite their southern assault being decimated, Russian forces pressed on with their northern mechanized attack. Staying out of sight of Ukrainian Javelins, they were instead met with swarms of FPV kamikaze drones carrying anti-tank munitions, which devastated the assault.

Footage reveals Russian and North Korean soldiers frequently grouping together, likely due to communication issues, as they were forced to improvise amid the chaos. However, this made them easy targets for Ukrainian artillery, eliminating large groupings with single shells.

After seeing yet another failed assault to break them out, several more North Korean soldiers lost faith in their Russian allies’ ability to lift the siege, again attempting to make a run for it while the Ukrainians were distracted by the northern assault. Unfortunately for the North Koreans, the Ukrainians had enough drones to go around, as they hunted down the North Koreans trying to escape the pocket.

Notably, many North Korean soldiers showed signs of exhaustion, as they often stumbled and were moving much slower than before, indicating that North Koreans are on the brink, and might soon surrender on masse for the first time in the war.

Overall, the Russians launched a disastrous assault, hoping to break the siege on the now desperate North Korean soldiers stuck in Nikolske. Ukrainian vigilance proved key in winning the battle, eliminating them with cluster munitions and precision drone strikes.

The fact that Russians are incorporating North Koreans again into their assault formations, indicates that they are running dangerously low on reserves, as these incorporations further lower the combat effectiveness of these groupings.


12,504 posted on 02/26/2025 5:44:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12503 | View Replies]

To: FtrPilot

Russia’s Ryazan oil refinery (big one, serving the Moscow region) hit hard for the anniversary commemoration.


12,505 posted on 02/26/2025 5:49:30 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 12489 | View Replies]

To: PIF

Glad to see Trump is getting a hold of fraudulent and wasteful spending, looks like more effective and targeted aid will be going to Ukraine to fight Dear Leader’s costly and unnecessary invasion.

Interesting oft repeated 😂 meme, so Trump is president and US still giving people the finger, Humm

At this point I can see where Kremlin directives may be all over the place. Trump good, Trump bad😎


12,506 posted on 02/26/2025 6:02:01 AM PST by blitz128
[ Post Reply | Private Reply | To 12503 | View Replies]

To: PIF

Silly PIF, there are no NORKS fighting in Russia 🍈😎


12,507 posted on 02/26/2025 6:03:59 AM PST by blitz128
[ Post Reply | Private Reply | To 12504 | View Replies]

To: PIF
Great idea - let’s give Russia some hard currency so they can rearm quicker and better!!


12,508 posted on 02/26/2025 6:05:40 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12503 | View Replies]

To: Dopey; PIF

12,509 posted on 02/26/2025 6:10:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12506 | View Replies]

Zelensky basically slaps @realDonaldTrump in the face.

"We don't owe the USA anything"

pic.twitter.com/Srt7lBIeKZ— Chay Bowes (@BowesChay) February 26, 2025


12,510 posted on 02/26/2025 6:26:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12501 | View Replies]

To: Vladimir
🍈


12,511 posted on 02/26/2025 6:39:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12510 | View Replies]

To: BeauBo
🇺🇦⚡️ On the night of February 26, 2025, Ukrainian Armed Forces' drone units, in cooperation with other defense components, struck several strategic Russian targets in Krasnodar and occupied Crimea.

This included the military airfields "Saky" and "Kacha" and the Tuapse oil refinery, which supplies oil products for the Russian army. At least 40 explosions were recorded at the refinery.

https://x.com/NOELreports/status/1894754261810262087

Awaiting BDA.


12,512 posted on 02/26/2025 7:09:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12505 | View Replies]

To: PIF
The crew of the 🇺🇦 MiG-29 40БрТА destroys the place of concentration of the 🇷🇺 invaders and their means of communication and electronic warfare.

https://x.com/Vijesti11111/status/1894573649539035493

Kudos to UKF target intel for locating the invaders.

The explosion appears to be from a French AASSM ‘Hammer’ guided bomb.


12,513 posted on 02/26/2025 7:14:31 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12512 | View Replies]

To: blitz128

Silly PIF, there are no NORKS fighting in Russia 🍈😎


Just Buryats using NORK equipment 🍈😎


12,514 posted on 02/26/2025 7:22:43 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12507 | View Replies]

To: PIF; LowIQ; Vladimir
🍈

Globalism is dead.


12,515 posted on 02/26/2025 9:11:21 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12511 | View Replies]

To: PIF
Footage reveals Russian and North Korean soldiers frequently grouping together, likely due to communication issues, as they were forced to improvise amid the chaos. However, this made them easy targets for Ukrainian artillery, eliminating large groupings with single shells.

This is the reason

Two North Korean prisoners of war, captured by Ukrainian forces last month, have spoken exclusively to the Chosunilbo at a prisoner-of-war (POW) camp in Ukraine.

Did you face any difficulties working with Russian troops? How did you communicate with them? “We used smartphone translation apps.
Had you used a smartphone before? “This was my first time using a translation app. I had never interacted with foreigners before.”

https://freerepublic.com/focus/news/3328416/posts?page=97#97

12,516 posted on 02/26/2025 9:35:27 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12504 | View Replies]

To: AdmSmith
🍈

Excellent news, things are breaking down nicely

See the Nullification Crisis of 1832-1833, centered in South Carolina for some relevant pre-Civil War history.


12,517 posted on 02/26/2025 9:39:00 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12516 | View Replies]

To: JonPreston

What is this utterly STUPID governor going to do when the IRS starts placing liens on homes in Maine, it is really quite amazing how STUPID these people are that are elected to office!!


12,518 posted on 02/26/2025 9:45:15 AM PST by Trump Girl Kit Cat (Yosemite Sam raising hell)
[ Post Reply | Private Reply | To 12517 | View Replies]

To: FtrPilot

“At least 40 explosions were recorded at the (Tuapse) refinery“

I am not a doctor, or a petroleum engineer, but that sounds bad.


12,519 posted on 02/26/2025 10:02:31 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 12512 | View Replies]

To: FtrPilot

“At least 40 explosions were recorded at the (Tuapse) refinery“

I am not a doctor, or a petroleum engineer, but that sounds bad.


12,520 posted on 02/26/2025 10:04:11 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 12512 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,481-12,50012,501-12,52012,521-12,540 ... 22,501-22,520 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson