Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,841-10,86010,861-10,88010,881-10,900 ... 18,941-18,953 next last
To: PIF; blitz128

Are thee 20,000 Poles genocidally mass murdered at Katyn by the Moscow Kremlin in included in the 20 billion figure? Enquiring minds want to know.


10,861 posted on 01/19/2025 8:03:23 PM PST by lodi90
[ Post Reply | Private Reply | To 10855 | View Replies]

Russian Offensive Campaign Assessment, January 19, 2025

The Ukrainian General Staff reported on January 18 that Russian forces used ammunition equipped with chemical agents banned by the Chemical Weapons Convention (CWC) 434 times in Ukraine in December 2024, contributing to a total of 5,389 documented cases since February 2023.[1] Ukraine’s radiation, chemical, and biological intelligence units are monitoring Russia’s use of banned chemical agents, which include using regulated K-51 and RG-VO grenade launchers to launch munitions containing chemical agents and ammunition containing unspecified hazardous chemicals that are banned in warfare under the 1925 Geneva Protocol and CWC. Ukrainian officials have previously reported on increasingly common instances of Russian forces using chemical substances in combat that are banned by the CWC, to which Russia is a signatory, and the Ukrainian General Staff noted that such violations have been systematic in the Russian military since February 2023.[2]

A Russian milblogger suggested that the Russian government may continue to import new military equipment from Iran following the signing of the Russia-Iran Strategic Partnership Agreement on January 17. A Russian milblogger claimed on January 18 that Russia might sell Iran advanced Su-35S, Su-30SM, and Su-57 fighter jets and S-300 air defense systems in exchange for advanced Iranian stealth strike and reconnaissance drones, Fateh-110 and Zolfaghar ballistic missiles, and long-range rotary mounted .50 caliber “Moharram” machine guns.[59] The milblogger postulated that the eventual arrival of Iranian ”Moharram” machine guns might help Russian forces counter Ukrainian naval drones in the Black Sea.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-19-2025


10,862 posted on 01/19/2025 10:26:23 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10826 | View Replies]

To: lodi90

The Russian stock market may collapse after Trump comes to power, experts have warned. If the new US leader’s rhetoric turns out to be tough on sanctions against Russia at the time of his inauguration, then Russian stocks are at risk of collapsing. If the US president talks about stabilization and negotiations to end the conflict in Ukraine, then the market has a chance to react positively.

https://t.me/bankrollo/37270

Check here
https://tradingeconomics.com/russia/stock-market

https://www.investing.com/currencies/usd-rub


10,863 posted on 01/19/2025 10:41:28 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10861 | View Replies]

To: BeauBo

Don’t forget the mustache 😂


10,864 posted on 01/19/2025 11:47:19 PM PST by blitz128
[ Post Reply | Private Reply | To 10859 | View Replies]

To: JonPreston

🍈 is posting must be morning in Russia, but that morning may turn into mourning at noon today😎

Ruble and stock market watch begins


10,865 posted on 01/19/2025 11:50:55 PM PST by blitz128
[ Post Reply | Private Reply | To 10854 | View Replies]

To: blitz128

Yes, Hitler’s was also bigger than little Putin’s.


10,866 posted on 01/20/2025 1:35:41 AM PST by BeauBo
[ Post Reply | Private Reply | To 10864 | View Replies]

To: AdmSmith

The world holds its breath, waiting to see what President Trump will do.


10,867 posted on 01/20/2025 1:45:08 AM PST by BeauBo
[ Post Reply | Private Reply | To 10863 | View Replies]


10,868 posted on 01/20/2025 3:32:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10791 | View Replies]

1,690 i.e. more than 1.17 Russians and Norks/min


10,869 posted on 01/20/2025 3:36:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10792 | View Replies]

As we America First'ers have been saying since Feb 24, 2022, Ukraine was just the latest Biden/Neocon misadventure, doomed to burden the American taxpayer and kill more than a million innocent Ukranian young men

How stupid can you people be?

********
********

3 years after Biden called for regime change in Moscow, and after shelling out $180+ billion on Ukraine aid, which mostly went to US contractors, the Biden admin claims it never believed Ukrainian victory was possible, and didn’t even believe retaking lost territory was possible

a href="https://t.co/sjkCb9TZia">https://t.co/sjkCb9TZia pic.twitter.com/nUEC16ZigF— Max Blumenthal (@MaxBlumenthal) January 20, 2025



10,870 posted on 01/20/2025 3:42:23 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10865 | View Replies]

To: BeauBo

10,871 posted on 01/20/2025 3:44:58 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10866 | View Replies]

To: JonPreston; All

IMHO Russia can have Ukraine.

Ukraine was full of corruption and Colonel Alexander ‘Flounder’ Vindman knew about it. They participated with Biden’s and Pelosi and others with paybacks. They have Ukraine GENERALS buying houses in California.

Maybe Putin would tell us where the money went.

Serious question: What is our strategic reason for supporting Ukraine...?


10,872 posted on 01/20/2025 3:49:40 AM PST by Mr. K (no consequence of repealing obamacare is worse than obamacare itself.)
[ Post Reply | Private Reply | To 10870 | View Replies]

To: Mr. K
IMHO Russia can have Ukraine. Ukraine was full of corruption and Colonel Alexander ‘Flounder’ Vindman knew about it

100%

Reports that Russian Units have broken through the defences of Pokrovsk and are fighting inside the town itself.

If confirmed, this is a complete catastrophe for the collapsing Ukrainian defence in the East. pic.twitter.com/eh1fvMMKNv— Chay Bowes (@BowesChay) January 19, 2025


10,873 posted on 01/20/2025 3:57:50 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10872 | View Replies]

Yet another LOW-IQ Ukraine war supporter

At the Inaugural Peace Ball, Rep. @CoriBush tells journalist @mtracey she voted to fund the Ukraine proxy war with billions in US taxpayer money because the Biden admin warned her " that Black and brown bodies" from the US would have had to fight if Ukraine was not fully armed

pic.twitter.com/9GEtMfZjIi— Max Blumenthal (@MaxBlumenthal) January 20, 2025


10,874 posted on 01/20/2025 4:40:27 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10873 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Insane Russian Attack: 50 Bikes, 100 Men, Zero Survivors! ]

Today [ Jan 19, 8 pm ], there is interesting news from the Siversk direction.

Here, in a desperate bid to break through Ukraine’s well-protected defense line in front of Siversk, Russian forces launched a massive assault using 50 motorcycles and light vehicles. Ukrainian defenders managed to adapt quickly and deal significant damage to this enemy attempt.

The Russian goal here is to penetrate the heavily fortified Vyimka-Zvanivka defensive belt, which serves as a critical shield for Siversk, preventing Russian forces from making any meaningful advances in the region. Having exhausted almost every other attack vector in the Siversk direction with little success, Russian commanders saw this last untouched sector as their only remaining option for a major push, even if it is very well protected.

The Vyimka-Zvanivka line is the gateway to Siversk, and breaching it would allow Russian forces to pressure Ukrainian defenders, paving the way for deeper advances. However, previous mechanized assaults in the Siversk direction were disastrous, costing Russians an entire army of tanks and vehicles.

The sheer scale of Russian losses forced the removal of Colonel General Gennady Anashkin after reports surfaced that his officers had submitted false battlefield reports to the Russian high command, where they exaggerated their progress.

With new leadership, Russian commanders are trying a completely different approach, shifting away from traditional armor-heavy offensives to fast-moving light vehicle attacks.

To avoid repeating past failures, Russian forces abandoned large, armored columns and relied on motorcycles and ATVs for maneuverability. Their strategy revolved around speed, unpredictability, and overwhelming Ukrainian defenses before they could react.

By launching rapid successive assaults, Russian troops hoped to bypass Ukraine’s artillery kill zones and force a breakthrough. The motorcycles’ ability to navigate rough terrain and evade FPV drone strikes also played into their tactical planning.

Russia’s logistics in the sector remain relatively efficient, enabling a steady flow of reinforcements, and allowing them to sustain high-tempo assaults, giving Ukrainians very little time to detect them. However, the almost total absence of armored protection proved to be a crucial weakness.

Once the attack was detected, Ukrainian forces swiftly exploited these vulnerabilities. The lightly armored vehicles offered no defense, leaving Russian troops completely exposed to drone strikes, artillery fire, and machine guns.

Despite their speed and maneuverability, the Russian assault was swiftly intercepted. Ukrainian defenders from the 10th Mountain Assault Brigade, Edelweiss, maintained constant drone surveillance, despite the previous low intensity of combat engagements, enabling an almost immediate response.

The hilly terrain with tree lines initially provided a slight advantage to the Russians, but as they crested the hill, Ukrainian forces efficiently targeted them.

Geolocated footage from the Ukrainian drone operators showcases how early the Russian group was detected, just as they were gathering to start their assault. There were also several armored vehicles present, not only to provide fire support and carry additional infantry on board, but also to diver Ukrainian fire away from the main group with motorcycles.

These BMP-2s became the first target of Ukrainian FPV drones and were finished off immediately, allowing the Ukrainians to focus on the motorcycles much earlier than expected. Interestingly Ukrainian forces also effectively jammed Russian drones with electronic warfare, bringing down almost 20 Russian strike and reconnaissance FPVs, successfully preventing them from providing fire support or reconnaissance data.

The next step was to target the Russian motorcycles, as they used over 40 of them in this assault alone. Unfortunately for Russians, their numbers alone offered them little advantage. Some were obliterated mid-charge, hurling riders through the air, while others were systematically picked off individually.

As panic set in, the dispersed Russian troops desperately sought cover in the nearby tree lines, only to be hunted down by Ukrainian kamikaze drones. Ukrainian soldiers also took a single Russian prisoner, the sole survivor of the assault, as all others were killed or wounded.

Overall, this motorcycle assault marks yet another humiliating failure in Russia’s ongoing struggle to gain ground in Siversk. The new “fast and light” approach has proven to be just as ineffective as the previous mechanized assaults, underscoring Ukraine’s superior battlefield awareness and rapid response capabilities.

Despite Russia’s continuous efforts, the Vyimka-Zvanivka defense line remains intact, keeping Siversk secure and further draining Russian manpower and resources in the process.


10,875 posted on 01/20/2025 4:58:14 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10869 | View Replies]

To: lodi90

Are thee 20,000 Poles genocidally mass murdered at Katyn by the Moscow Kremlin in included in the 20 billion figure?

Who knows where or how 🍈 came up with the 20 B number ... perhaps he was counting all the people who had lived up until then.


10,876 posted on 01/20/2025 5:04:34 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10861 | View Replies]

To: AdmSmith

... advanced Iranian stealth strike and reconnaissance drones, Fateh-110 and Zolfaghar ballistic missiles, and long-range rotary mounted .50 caliber “Moharram” machine guns.

The milblogger postulated that the eventual arrival of Iranian ”Moharram” machine guns might help Russian forces counter Ukrainian naval drones in the Black Sea.

https://en.wikipedia.org/wiki/Moharram_(Gatling_gun)


10,877 posted on 01/20/2025 5:07:21 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10862 | View Replies]

To: blitz128

I see another of 🍈’s friends ( 🦠) has chipped in - he’s has a pretty nasty track record.


10,878 posted on 01/20/2025 5:13:10 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10865 | View Replies]

To: PIF

Let them in😂


10,879 posted on 01/20/2025 6:30:43 AM PST by blitz128
[ Post Reply | Private Reply | To 10878 | View Replies]

To: blitz128
The US is about to flood the world with liquefied natural gas. Russia is done.

https://x.com/JayinKyiv/status/1874074636222423510

10,880 posted on 01/20/2025 7:49:40 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10879 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,841-10,86010,861-10,88010,881-10,900 ... 18,941-18,953 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson