Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,681-10,70010,701-10,72010,721-10,740 ... 19,021-19,024 next last
To: JonPreston

10,701 posted on 01/15/2025 3:47:04 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10700 | View Replies]

To: JonPreston

🚨BREAKING: Speaker Johnson, in what appears to be a direction from Donald Trump, has decided to remove Rep. Mike Turner as chair of the House Intelligence Committee, according to Punchbowl News

His “sin”? He’s too pro-NATO, too supportive of Ukraine,

pic.twitter.com/9opf5eopWL— Republicans against Trump (@RpsAgainstTrump) January 15, 2025


10,702 posted on 01/15/2025 3:50:59 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10701 | View Replies]

To: JonPreston

If NeoCucks are upset, that is a win for America.


10,703 posted on 01/15/2025 4:02:58 PM PST by OldHarbor
[ Post Reply | Private Reply | To 10702 | View Replies]

To: OldHarbor

100% OH


10,704 posted on 01/15/2025 4:27:58 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10703 | View Replies]

To: blitz128; FtrPilot

One of the highest GDP areas in Russia is Tatarstan due to the oil there. When I visited Kazan a few years ago I was amazed to see large packs of stray dogs roaming the city streets of one of Russia’s weathiest cities. It’s hilarous to see the Moscow Kremlin’s dupes and useful fools airbrush a fantasy Russia that does not exist. It is, of course, an over 100 year old tradition among the dimmest bulbs on our planet.


10,705 posted on 01/15/2025 5:59:26 PM PST by lodi90
[ Post Reply | Private Reply | To 10683 | View Replies]

To: JonPreston

Nick Sortor, on X: “”JUST IN: President Trump PERSONALLY requested Mike Johnson remove RINO Mike Turner from powerful position of Chair of the House Intelligence Committee, per WaPo We’re weeding out those who will intentionally impede Trump’s agenda. Good on you, @SpeakerJohnson Turner voted AGAINST the censure of Adam Schiff, even though Turner KNEW Schiff lied about ‘Russian collusion’”


10,706 posted on 01/15/2025 6:02:21 PM PST by BeauBo
[ Post Reply | Private Reply | To 10702 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, January 15, 2025

A Russian source claimed that Ukrainian drone and artillery capabilities are providing Ukrainian tanks with tactical advantages over Russian tanks in unspecified, select areas of the frontline. A Russian milblogger claimed on January 12 that Russian forces are unable to field tanks and armored vehicles in frontline areas where Ukraine has deployed at least two Ukrainian first-person view (FPV) strike drone companies and two Ukrainian reconnaissance drone companies operate because Ukrainian drone operators strike most or all Russian armored vehicles three to six kilometers from the frontline.[11] The milblogger also claimed that Russian forces are also unable to field tanks in frontline areas where Ukrainian forces have a sufficient number of shells due to the high accuracy of Ukrainian artillery strikes. The milblogger complained that Russian drones are less effective than the Ukrainian drones and that the Russian military command only supplies Russian FPV operators advanced FPV models operating on non-standard frequences and fiber-optic drones — both of which are more resistant to Ukrainian electronic warfare (EW) — to priority sectors of the frontline. The milblogger further claimed that an insufficient amount of Russian artillery coupled with insufficient Russian drone capabilities in select sectors of the frontline allow Ukrainian forces to field tanks more easily for indirect and direct fire. Effective Ukrainian drone and artillery operations in select areas of the frontline may be straining Russia's ability to field tanks amid reports that Russian forces continue to accrue vehicles losses that are likely unstable in the medium term.[12] Ukraine's ability to damage and destroy Russian armored vehicles and tanks with FPV drones and artillery will likely strain Russia's ability to replace such losses as current armored vehicle and tank production rates indicate that these losses will be prohibitive over the longer term.

Transnistrian President Vadim Krasnoselsky announced on January 15 that Russia will soon provide Transnistria with gas as “humanitarian aid” but did not specify the delivery date or method.[13] Krasnoselsky visited Moscow from January 10 to 14 and negotiated possible gas deliveries to Transnistria with the Russian Energy Ministry.[14] Krasnoselsky added that Russia will provide Transnistria with enough gas for thermal power engineering, industrial enterprises, and civilian use, noting that Russia will not be supplying the rest of Moldova with gas.[15]

Armenia continues to enhance its relations with Western partners amid waning relations with Russia. The US State Department reported on January 14 that Armenia and the US launched the US–Armenia Strategic Partnership Commission, signaling a significant step in their bilateral relations.[16] US Secretary of State Antony Blinken and Armenian Foreign Minister Ararat Mirzoyan formalized the agreement aimed at expanding bilateral cooperation in economic, security, defense, and governance sectors. Blinken emphasized US support for Armenia's sovereignty and territorial integrity while Kremlin Spokesperson Dmitry Peskov criticized the partnership agreement, accusing the US of destabilizing the South Caucasus.[17] Russian Deputy Prime Minister Alexei Overchuk and Foreign Minister Sergei Lavrov also expressed dissatisfaction with Armenian government's January 9 approval of a European Union (EU) accession bill. Overchuk and Lavrov argued that Armenia's potential future EU membership is incompatible with Armenia's membership in the Russian-led Eurasian Economic Union (EAEU) and framing Armenia's EU accession bill as a potential withdrawal from the EAEU.[18] Overchuk and Lavrov also claimed that such decisions are Armenia's sovereign right yet highlighted potential consequences, reinforcing Kremlin's longstanding pattern of threatening and pressuring neighboring countries through indirect and direct means. The Kremlin reactions to Armenia's deepening ties with the West demonstrate a broader Russian strategy of undermining the sovereignty of neighboring and previously colonized countries through initial ultimatums and veiled coercion, often escalating to direct action and military violence when Russia's influence is challenged, as is the case in Georgia, Moldova, and Ukraine.

Ukrainian President Volodymyr Zelensky stated on January 15 that about 600,000 Russian soldiers are currently operating in Ukraine.[57] Russian President Vladimir Putin claimed in June 2024 that nearly 700,000 Russian soldiers were fighting in Ukraine.[58] Ukraine's Main Military Intelligence Directorate (GUR) Deputy Head Major General Vadym Skibitskyi reported in November 2024 that Russia had deployed nearly 580,000 personnel to Ukraine.[59]

The Russian Ministry of Defense (MoD) continues to recruit foreigners to fight in its war against Ukraine. Radio Free Europe/Radio Liberty's (RFE/RL) Sistema project reported on January 15 that a Central African Republic (CAR) citizen who fought in an assault company of the Russian 155th Naval Infantry Brigade (Pacific Fleet, Eastern Military District [EMD]) was killed in action near Novoivanovka, Kursk Oblast, marking the first confirmed case of a CAR citizen killed while fighting in Kursk Oblast since Ukraine's incursion in August 2024.[61] The CAR citizen's brother told Sistema that the soldier signed a military contract with Russia's Ministry of Defense (MoD) in September 2024, and a source close to the 155th Naval Infantry Brigade's command told Sistema that there are “plenty” more CAR citizens fighting in Kursk Oblast, but the exact number is unknown.[62]

A Russia insider source blamed an officer of the Russian General Staff for the short training period for Russian servicemembers and claimed this contributed to Russia's failure to repel the Fall 2022 Ukrainian counteroffensive in Kharkiv Oblast. The insider source responded on January 15 to a recent complaint from a Russian milblogger and former Storm-Z instructor that the recent two-to-three-week training periods for Russian soldiers are inadequate.[64] The insider source claimed that the Head of the Russian General Staff's Main Organizational and Mobilization Directorate and Deputy Chief of the General Staff General Yevgeny Burdinsky is responsible for Russia's training failures, including building new brigades and formations entirely from new recruits rather than transferring experienced personnel from other units.[65] The insider source claimed that this failure prevented the Russian 3rd Army Corps (AC) (formed in late Summer 2022) from defending against the Fall 2022 Ukrainian counteroffensive in Kharkiv Oblast and rendered its 72nd, 85th, 88th, and 123rd motorized rifle brigades and 6th Motorized Rifle Division practically combat incapable. The insider source claimed that Burdinsky only maintains his post due to his personal relationship with Russian Chief of the General Staff Army General Valery Gerasimov.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-15-2025

10,707 posted on 01/16/2025 3:29:31 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10685 | View Replies]

To: AdmSmith
1,480 i.e. more than 1.02 Russians and Norks/min>


10,708 posted on 01/16/2025 3:34:48 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10688 | View Replies]

Trump tells people recommending staffing to him NOT recommend people who have worked for:

- "Birdbrain" Nikki Haley
- "Dumb as a rock" John Bolton
- Charles Koch/Americans for "No" Prosperity
- Mike Pence
- "Disloyal warmongers" Dick Cheney and "psycho daughter" Liz
- Mitt Romney
- Paul Ryan
- "General(?)" Mark Milley and James Mattis - Mark Yesper
- Anyone with "Trump derangement syndrome
- Anyone who wears a Ukrainian flag lapel pin.

10,709 posted on 01/16/2025 4:02:02 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10708 | View Replies]

To: FtrPilot

What China’s Next Generation Stealth Jet Reveal Really Means
Deep analysis on China’s new advanced tailless ‘fighter’ aircraft, what we know and what we don’t, and their broader implications.
https://www.twz.com/air/what-chinas-next-generation-stealth-jet-reveal-really-means


Norwegian F-35s Scrambled In Poland During Russian Missile Strikes On Ukraine
Since Russia launched its full-scale invasion, multiple missiles and drones have entered Polish airspace, which is now also defended by Norwegian assets.
https://www.twz.com/air/norwegian-f-35s-scrambled-in-poland-during-russian-missile-strikes-on-ukraine


10,710 posted on 01/16/2025 4:10:41 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10681 | View Replies]


10,711 posted on 01/16/2025 4:12:05 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10709 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ETCM

Kamikaze meat assaults are no longer just a Russian thing, the North Korean hordes are also now mere ammo sponges.

Putin is one of the greatest mass murderers in history.

https://x.com/JayinKyiv/status/1879454824527479171
30 sec video


10,712 posted on 01/16/2025 4:15:18 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10706 | View Replies]

To: AdmSmith

Many usuals here see Trump becoming president as a positive for their pro putin positions, disguised as pro American
I think otherwise. Putin shows no signs of being willing to “negotiate “ beyond his position of give me everything I want, and I believe that is contrary to what President Trump will demand of Putin.
Trump has dealt with thugs and corrupt politicians like putin his whole life, and he knows how to deal with him(them).
Just as he pulled out the picture of the Taliban leader’s home, and laid down the law to him, so now will President Trump
Despite all the usuals laying the blame of all the death and destruction on
Ukraine, Trump sees that Putin is responsible.
President Trump will take appropriate actions against putin.
To do otherwise would be to embolden and empower putin as well as Xi, Kim, and Iran……
Lastly, as I thought , there will be no ceasefire or peace negations with hamas, and even if there was one on paper hamas will never honor it.
Putin is no different. Putin will need to be defeated, and I think President Trump knows this.


10,713 posted on 01/16/2025 4:18:36 AM PST by blitz128
[ Post Reply | Private Reply | To 10708 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Aviation Is Crippled. 1 Million Tons of Jet Fuel Destroyed ]

Today [ Jan 15, 8 pm ], there is a lot of news from the Russian Federation.

Here, Ukraine intensified its series of deep strikes into Russian territory, continuing a calculated campaign to dismantle Moscow’s logistical and operational capabilities.

Dealing devastating damage to critical infrastructure, these precision operations aim to weaken Russia’s ability to sustain its war effort.

The target of the first attack was the Engels Air Base in the Saratov region. According to the latest reports, the fire has already destroyed 3 massive fuel tanks and damaged 6 more, holding over 1,000,000 cubic meters of fuel.

Engels is a vital hub for Russian strategic aviation and has now been targeted twice by Ukrainian forces, with the latest strike igniting an inferno that has been burning for almost a week. This base serves as a launch point for long-range bombers involved in missile attacks on Ukraine, making it a priority target for the Ukrainian armed forces.

The destruction of fuel depots at Engels, which support these bombers, has created logistical challenges, severely disrupting Russian air operations. Russian emergency services have struggled to contain the blaze for over 5 days, underscoring the scale of the destruction. This operation exemplifies Ukraine’s ability to reach deep into Russian territory and target assets critical to Moscow’s war machine.

In order to achieve this goal and ensure the maximum level of destruction, Ukrainians utilized a 3-phase strategy. 1st, a general drone strike is launched to trigger and identify air defense positions and establish precise flight patterns. 2nd, pinpoint strikes neutralize these defenses; and finally, the main blow is delivered against high-value targets under clear skies.

The 2nd and 3rd strikes in the Ukrainian campaign exemplify this strategy with attacks on Taganrog and Millerovo airfields in the Rostov region. Ukrainian drones overwhelmed Russian air defenses, forcing them to engage and reveal their positions.

This preliminary phase was followed by targeted strikes that destroyed critical air defense systems, such as the Pantsir-S1, S-300, and Buk-M1 units. By disabling these defenses, Ukraine ensured unimpeded access for subsequent strikes on vital targets.

The same methodology was employed in the next strike in Rostov, where drones overloaded Russian air defense, followed by a direct hit by a Neptune missile delivering a devastating blow against a warehouse with reconnaissance drones which conducts enemy strikes on Ukrainian cities and the front line. Residents complained about the loud explosions heard throughout the whole night and the Security Service of Ukraine commented on the next day that their work in the enemy rear will continue.

One of the most important targets was the command post of Russia’s 8th Guards Combined Arms Army in Khartsyzk, Donetsk region, destroyed by a precision strike. This facility was pivotal in coordinating Russian operations in the Kurakhove direction.

In the next strike in Krasnodar Krai, Ukrainian drones struck the base of the 238th Artillery Brigade and a nearby airfield, adding to the challenges faced by Russian ground forces.

Ukrainian forces also struck the naval base in Novorossiysk in a daring drone operation, which is a home to elements of the Black Sea Fleet. Though details of the damage remain unclear, the attack signals Ukraine’s intent to continue tormenting the Russian naval dominance in the Black Sea.

Finally, a significant blow was also dealt in Tatarstan, where a drone strike ignited a massive fire at the Taneco oil refinery. This facility is a crucial component of Russia’s energy infrastructure, and the damage further strains Moscow’s ability to sustain its war economy.

Overall, these strikes serve clear strategic and operational goals. By targeting logistical hubs, airfields, command posts, and key infrastructure, Ukraine seeks to degrade Russia’s ability to wage war effectively. The destruction of air defenses and drone warehouses reduces Moscow’s capacity to launch precision strikes, while attacks on fuel depots and oil refineries, hinder its ability to sustain operations.

By targeting critical assets deep within Russian territory, Ukraine forces Moscow to divert resources to defense and reassess its operational strategy.


10,714 posted on 01/16/2025 4:20:10 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10708 | View Replies]


10,715 posted on 01/16/2025 4:20:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10711 | View Replies]

To: AdmSmith

30 Norks cross some fields. 16 remain when the video ends.


10,716 posted on 01/16/2025 4:24:00 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10712 | View Replies]

To: JonPreston

10,717 posted on 01/16/2025 4:26:34 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10715 | View Replies]

To: BeauBo

Trump fully understood what he meant by the enemy within, and we are seeing that now. The deep state is a party less entity.

The one criticism I have of President Trump’s first term is that he failed to recognize that.
He will not make that same mistake again.
The enemies he had then are the same enemies he has now, and it will be a difficult task to clean out house, but it is evident that he will.
This action is just another example of that


10,718 posted on 01/16/2025 4:27:59 AM PST by blitz128
[ Post Reply | Private Reply | To 10706 | View Replies]

To: blitz128

“Trump has dealt with thugs and corrupt politicians like putin his whole life”

In his first meeting with Putin in his first term, Trump reportedly laid down the law to Putin over Ukraine, telling him that if he invaded, he could say goodbye to all those beautiful golden domes in Moscow.

I expect that in private, he will lay down the law again, while in public, Trump has sought to create an environment where Putin could save face enough to survive accepting Trump’s demands.


10,719 posted on 01/16/2025 4:41:10 AM PST by BeauBo
[ Post Reply | Private Reply | To 10713 | View Replies]

To: blitz128

Turner proved himself to be anti-Trump, protecting and collaborating with those who abused FISA to spy on the Trump campaign, and lied to try and frame him.

He was fired by the Speaker of the House who got the last big Ukraine aid package passed, with the blessing on then Presidential candidate Trump.


10,720 posted on 01/16/2025 5:01:17 AM PST by BeauBo
[ Post Reply | Private Reply | To 10718 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,681-10,70010,701-10,72010,721-10,740 ... 19,021-19,024 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson