Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,561-10,58010,581-10,60010,601-10,620 ... 18,981 next last
To: ANKE69
May I steal this picture??

100% ANKE69!

10,581 posted on 01/11/2025 5:22:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10552 | View Replies]

To: PIF

🍈 couldn’t resist 😂


10,582 posted on 01/11/2025 7:37:35 AM PST by blitz128
[ Post Reply | Private Reply | To 10579 | View Replies]

To: blitz128
The latest meeting of the Ukraine Support Contact Group (UDCG) was held at Ramstein Air Base in Germany, led by US Secretary of Defense Lloyd Austin. The Czech Republic was represented by Defense Minister Jana Černochová, who informed allies about current ammunition deliveries to the Ukrainian battlefield and other forms of support.

The Czech Republic continues to focus mainly on the supply of large-caliber ammunition,” said Defense Minister Jana Černochová after the meeting. Last year, the Czech Republic supplied Kiev with around 1.5 million pieces of large-caliber ammunition, a third of which was in the 155 mm caliber. According to the minister, the Czech Republic wants to continue these supplies this year as well. “Deliveries present a huge logistical challenge, but they are working well. We all recognize the importance of military support, especially at this time, which is crucial for the future development of Ukraine,” she said.

https://mocr.mo.gov.cz/informacni-servis/zpravodajstvi/v-nemeckem-ramsteinu-se-opet-jednalo-o-podpore-ukrajiny—naposledy-za-ucasti-ministra-austina-255902/

10,583 posted on 01/11/2025 8:35:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10582 | View Replies]

To: blitz128

🇷🇺🍈😰


10,584 posted on 01/11/2025 8:36:49 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10582 | View Replies]

To: marcusmaximus

🇺🇦💸 Ukrainian kids of rich officials speed through Kiev and throw dollar bills around!

Western taxes at work!

pic.twitter.com/R5XYpy23bc— Lord Bebo (@MyLordBebo) January 11, 2025


10,585 posted on 01/11/2025 10:48:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 42 | View Replies]

‼️🇺🇸🇺🇦Ukrainian shock: the US and Germany have become Russia's largest foreign "sponsors," — Newsweek

▪️According to the publication, 123 large American companies continue to do business with Russia (there are about 328 of them in total). In 2023, these companies paid more than… pic.twitter.com/bM7KxEOY7L— Zlatti71 (@Zlatti_71) January 11, 2025

Ukrainian shock: the US and Germany have become Russia's largest foreign "sponsors," — Newsweek

▪️According to the publication, 123 large American companies continue to do business with Russia (there are about 328 of them in total). In 2023, these companies paid more than $1.2 billion in taxes.

▪️The second largest foreign taxpayer in Russia in 2023 was Germany ($693 million in tax payments), the third was Austria ($579 million).

- RVvoenkor


10,586 posted on 01/11/2025 11:39:54 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10585 | View Replies]

To: AdmSmith

Kremlin snuff box, 01/11/24
https://t.me/s/kremlin_secrets

Fuel oil stains reached Yalta and Evpatoria. But something’s missing

The sinking of 2 tankers in the Black Sea will have serious consequences for the environment. According to the Governor of the Krasnodar Territory, Veniamin Kondratyev, there may be about 5,000 tons of fuel oil at the bottom of the Black Sea alone. And this despite the fact that volunteers and emergency workers have been collecting fuel oil on the coast of the Krasnodar Territory for almost a month now.

Recently, fuel oil stains began to be noticed on the Crimean coast. In Kerch, Evpatoria, Yalta and other areas of the peninsula.

Many people have a silent question - why, almost a month after the accident, the fuel oil has still not been extracted and removed? Everyone remembers how in Kuban [ https://t.me/kremlin_secrets/5074 ], fuel oil collected by volunteers was washed back into the sea due to the inaction of local authorities. Will the governor be held accountable for this?

Rumor has it that Kondratyev did not pay attention to the tanker accident at all. Interlocutors close to him told us that in the first days he “hoped that the fuel oil stains would be carried away from the Kuban and closer to the Crimea.”

How to understand this position of the governor? We don’t really believe in karma, but Kondratiev is firmly seated in his chair and cannot cope with challenges, this is already obvious. And if there is a crime, then there must be punishment.


10,587 posted on 01/11/2025 12:39:01 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10583 | View Replies]

To: AdmSmith

Kremlin snuff box, 01/11/24
https://t.me/s/kremlin_secrets

A difficult month lies ahead. A few words about drone attacks in our rear

In recent weeks, the enemy has stepped up massive drone attacks deep into Russia. Last night, in particular, the Tambov region came under attack, but not only it. Often the target of an attack is military targets, as was the case recently in the Saratov region [ https://t.me/kremlin_secrets/5141 ].

Our sources are convinced that attacks will become more dense in the coming month.

“Now there is a fierce battle going on. Obviously, Kyiv wants to show the new authorities in the United States that it can continue to resist. We, for our part, also need to show the result. All forces have been thrown,” a source close to Andrei Belousov told us.

Intelligence reports that the enemy has accumulated a certain stock of drones and missiles. At the same time, the Armed Forces of Ukraine use new developments, which complicates their elimination.

“They launch everything, different drones with different control systems. It’s difficult to cover everything with electronic warfare, and there aren’t enough air defense systems,” says an interlocutor [ https://t.me/kremlin_secrets/5067 ] directly involved in repelling enemy air attacks.

He emphasized that the lack of combat payments from the air defense officers [ https://t.me/kremlin_secrets/5123 ], who repel attacks in the rear, also does not add motivation to our guys. The interlocutor asked to raise the issue of additional payments again, because these guys are directly involved in hostilities. And it is worth correcting the injustice with their financial support.


10,588 posted on 01/11/2025 12:42:45 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10583 | View Replies]

To: AdmSmith

Sanctions continue to ratchet.

Kyiv Independent reports:

“European Commission plans to begin drafting new sanctions against Russia next week, with the goal of approving the package on Feb. 24 — the third anniversary of Russia’s full-scale invasion of Ukraine, Polish RMF FM reports.

Starting Jan. 14, the European Commission will hold consultations with EU member states on the 16th sanctions package, according to European diplomats.”


10,589 posted on 01/11/2025 5:42:44 PM PST by BeauBo
[ Post Reply | Private Reply | To 10577 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, January 11, 2025

Ukrainian forces reportedly captured the first North Korean prisoners of war (POWs) in Kursk Oblast. Ukraine's Security Service (SBU) stated on January 11 that elements of the Ukrainian Special Operations Forces (SSO) captured a North Korean soldier in Kursk Oblast on January 9 and that Ukrainian Airborne Assault Forces recently captured a second North Korean solider in the area on an unspecified date.[1] The SBU stated that Ukrainian authorities are working with South Korean intelligence to communicate with the POWs as they do not speak English, Russian, or Ukrainian. One of the POWs was carrying a Russian military registration card from the Tuva Republic that Russian authorities reportedly issued him in Fall 2024. The POW told Ukrainian authorities that he had undergone coordination training with Russian forces for only one week before deploying to combat and that he thought he was going to a training exercise in Russia, not to the war in Ukraine. Ukrainian President Volodymyr Zelensky stated that usually Russian or North Korean forces kill wounded North Korean personnel in order to conceal their participation in the war.[2]

North Korean forces are reportedly deploying large assault groups to combat operations despite frequent Ukrainian drone strikes, which is likely contributing to North Korea's high casualty rates and will likely affect the lessons that the North Korean military command will learn from fighting in the war. The Washington Post reported on January 11 that North Koreans fighting in Kursk Oblast are attacking in large groups with support from Russian artillery and drones, unlike Russian forces who usually move in smaller groups.[3] North Korean soldiers are also reportedly ignoring Ukrainian drones and continuing to move forward despite drone strikes on personnel. The Washington Post reported that Russian forces are following behind North Korean advances in order to “stabilize the gains,” but a Ukrainian solider operating in Kursk Oblast reported that communications issues between Russian and North Korean forces may be slowing Russian efforts to consolidate new positions. The Ukrainian soldier stated that North Korean forces launched an assault consisting of 400 to 500 personnel in December 2024, during which North Korean forces outnumbered Ukrainian forces six-to-one. Ammunition shortages reportedly forced the Ukrainian forces to withdraw after eight hours of fighting — suggesting that North Korean forces are heavily relying on a superior number of personnel to advance despite poor tactics. The solider stated that Ukrainian forces had inflicted significant losses on Russia's 810th Naval Infantry Brigade (Black Sea Fleet [BSF], Southern Military District [SMD]), possibly pushing the Russian military command to deploy North Korean forces to Kursk Oblast sooner than planned. Western officials have recently noted that North Korean forces are suffering high casualties, including at least one instance of roughly 1,000 casualties in Kursk Oblast in only one week in late December 2024.[4] Zelensky reported on January 5 that 3,800 North Korean personnel have been killed or wounded in Kursk Oblast — roughly a third of the reported 12,000 total North Korean personnel in Kursk Oblast — and stated that North Korean forces lost up to a battalion of infantry near Makhnovka, Kursk Oblast on January 3 and 4 alone.[5] ISW continues to assess that North Korea's ability to learn and integrate lessons from fighting alongside Russian forces will likely be significantly degraded if the Russian military command uses North Korean troops in highly attritional infantry-led assaults in similar or greater sizes than it conducts with most Russian personnel.[6] North Korean forces’ inability or refusal to learn to effectively counter drones will also affect the lessons they can learn from the war.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-11-2025

10,590 posted on 01/12/2025 2:21:14 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10573 | View Replies]

1,750 i.e. more than 1.21 Russians and Norks/min


10,591 posted on 01/12/2025 2:32:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10575 | View Replies]

12JAN2024 In Engels, Saratov Region, an oil depot attacked by Ukrainian drones has been burning for the fourth day. As the region’s governor Busargin wrote on his Telegram channel, “the process of controlled fuel burnout continues.”

https://x.com/Q0MT6pFmbVqynsM/status/1878354603785199812


10,592 posted on 01/12/2025 2:43:47 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10522 | View Replies]

One of russia’s largest oil refineries, “Taneko,” is on fire after being targeted by Ukrainian drones, which managed to reach Tatarstan, 1,000 kilometers from the border. This demonstrates the only language russia seems to understand: the language of strength.

https://bsky.app/profile/meanwhileua.bsky.social/post/3lfiy3zmur42l
15 sec video

A Ukrainian drone hit the Taneko oil refinery in Tatarstan, Russian Telegram channel ASTRA reported on Jan. 11. The refinery is one of the country's largest oil-processing facilities.

Workers at the refinery in Nizhnekamsk were evacuated amid the attack, and local footage showed smoke rising from the site. Andrii Kovalenko, Head of Ukraine's Center for Countering Disinformation, confirmed the strike, and emphasized its strategic importance. “The refinery plays a key role in providing fuel to the Russian military. Taking out refineries and oil depots directly affects Russia's ability to wage an intensive war,” he said. The refinery, which processes over 16 million tons of oil annually, was previously targeted in a drone attack in spring 2024, causing damage to its primary processing unit. Taneko refinery is located in the city of Nizhnekamsk, around 1,300 kilometers from the country's border with Ukraine.

https://kyivindependent.com/ukrainian-drone-hits-large-oil-refinery-in-russias-tatarstan-head-of-ukraines-center-for-countering-disinformation-confirms/


10,593 posted on 01/12/2025 2:51:18 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10592 | View Replies]

Zelenskyy: Our soldiers have captured North Korean military personnel in the Kursk region. Two soldiers, though wounded, survived and were transported to Kyiv, where they are now communicating with the Security Service of Ukraine.

This was not an easy task: Russian forces and other North Korean military personnel usually execute their wounded to erase any evidence of North Korea's involvement in the war against Ukraine.

I am grateful to the soldiers of Tactical Group No. 84 of the Special Operations Forces of the Armed Forces of Ukraine, as well as our paratroopers, who captured these two individuals. As with all prisoners of war, these two North Korean soldiers are receiving the necessary medical assistance.

I have instructed the Security Service of Ukraine to grant journalists access to these prisoners. The world needs to know the truth about what is happening.

https://x.com/ZelenskyyUa/status/1878046090018042169

The Security Service of Ukraine (SBU) said it has questioned the two soldiers through Korean interpreters in cooperation with South Korea's National Intelligence Service (NIS) as they do not speak Ukrainian, Russian or English. It said that one of the soldiers had a Russian military identification card in the name of another person registered in Russia. The soldier said he was given the document last autumn when he said some North Korean units took part in a one-week training event with Russian forces. "It is noteworthy that the prisoner ... emphasizes that he was allegedly going for training, not to fight a war against Ukraine," the SBU said in a release.

The South Korean spy agency later confirmed Ukraine's capture of the two soldiers, also quoting one of them as saying that there have been "considerable" casualties among North Korean soldiers in Russia. "(We) will continue to share information related to the North Korean prisoners in close cooperation with Ukraine's intelligence authorities," the NIS said, adding that the injured soldiers are not in any critical condition.
North Korea is estimated to have sent some 11,000 troops to support Russia in its war against Ukraine, according to South Korean officials. The NIS told lawmakers here last month that at least 100 North Koreans have been killed, with around 1,000 others injured.

https://en.yna.co.kr/view/AEN20250112000651315

10,594 posted on 01/12/2025 3:09:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10593 | View Replies]

To: AdmSmith

“ The Ukrainian soldier stated that North Korean forces launched an assault consisting of 400 to 500 personnel in December 2024, during which North Korean forces outnumbered Ukrainian forces six-to-one. Ammunition shortages reportedly forced the Ukrainian forces to withdraw after eight hours of fighting — suggesting that North Korean forces are heavily relying on a superior number of personnel to advance despite poor tactics”

We have seen this act play out before, had an uncle in Korean War, he disputes the idea that we didn’t know that the Chinese had infiltrated the lines. He said we knew and we prepared but we simply ran out of ammunition when the assault came.

Kim couldn’t give a rats ass about NK casualties, I am sure he is getting well compensated amd if any of this is being reported to NK people or service members it is being reported with glowing stories of victory and heroism.


10,595 posted on 01/12/2025 4:20:02 AM PST by blitz128
[ Post Reply | Private Reply | To 10590 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Brutal. North Koreans Used as Cannon Fodder to Check Firing Positions for The Russians ]

Today [ Jan 11, 8 pm ], there are a lot of important updates from the Kursk direction.

Here, the Russians launched a renewed assault on Malaya Loknya as an opportunistic response to the Ukrainian offensive northeast of Sudzha, integrating North Korean human shields into their assault groups. However, Ukrainians were shown to have taken the right precautions, dismantling the combined assault from the safety of their basements.

The goal of the Russian forces was to try to take control of Malaya Loknya and cut off the northern part of Kursk salient. This would allow the Russians to reduce the length of the frontline, by forcing a large number of Ukrainian forces to withdraw or surrender, and allow them to attack further south toward Sudzha.

Malaya Loknya is the second most powerful Ukrainian stronghold in the Kursk salient after Sudzha, as it serves both as a logistical hub, and a powerful stronghold due to the local prison.

Control of Malaya Loknya allows the Ukrainians to effectively defend the northern part of the Kursk salient since the fortified positions allow for the establishment of underground ammunition storages, while the town’s infrastructure allows for the accumulation of a large Ukrainian rapid response force.

Once Ukrainians launched their offensive northeast of Sudzha, Russian commanders believed that Ukrainians had redirected all their forces here, at the expense of their defense in Malaya Loknya, making Russians believe that Malaya Loknya was ripe for the taking.

To test the Ukrainian defenses for weak spots, Russians sent in the North Koreans as a first meat wave assault to probe Ukrainian defenses, which were promptly eliminated by Ukrainian drones, and a final clearing operation.

Once the North Korean meat wave assaults had revealed Ukrainian positions, Russians integrated Russian soldiers into these units, who had access to armored vehicles and artillery support. Ukrainian soldiers on the ground also reported an unprecedented number of Russian air strikes in the Kursk direction, as images of contrails in the skies above Kursk only reinforced these claims.

The main Russian advantages here are the forests and the village located to the west of Malaya Loknya. The houses and nearby forests allow the Russians and North Koreans to accumulate a large number of soldiers, enabling them to achieve numerical superiority over the Ukrainians.

Furthermore, the activity of the Russian Air Force provided them with a significant firepower advantage, suppressing Ukrainian positions ahead of main Russian assaults.

However, the terrain configuration heavily favored Ukrainians, as the prison complex on the high ground overlooked the Russian approaches to the settlements. Ukrainians also took precautional measures, scattering anti-tank landmines with drones to further complicate any Russian mechanized assault over the fields.

On top of that, the Russian mechanized units, unlike infantry, must traverse 10 kilometers to reach the frontline positions, while the frontline is less than 500 meters away from the Ukrainian supply hub at Malaya Loknya, allowing Ukrainians to quickly deploy a response force to counter the Russian assaults.

To minimize losses from Russian airstrikes, Ukrainians also stationed a minimal number of soldiers within Malaya Loknya on purpose, taking cover in basements and underground structures to survive the attacks.

Since the main attack consisted of Russian mechanized units, Ukrainians could dismantle them from their basements through the previously placed anti-tank mines, drones, and concentrated artillery fire, while the main Ukrainian contingent remained safely in Malaya Loknya to counterattack the surviving Russian soldiers.

Combat footage from the area reveals a platoon of Russian BTR-82A and Tiger armored personnel carriers on their way toward Malaya Loknya. Unfortunately for the Russians, the lead vehicle was destroyed by a landmine, whereafter the rest quickly followed.

Subsequently, the Russian and North Korean infantrymen who dismounted and attempted to hold on to new positions in the area were targeted and cleared out by Ukrainian counterattacks, with concentrated tank fire eliminating the remaining holdouts.

Overall, the Ukrainians accepted the loss of some ground and used it to drain the Russian counteroffensive wave that was desperately launched to quickly take Malaya Loknya, while Ukrainians attacked Bolshoe Soldatskoe.

This tactic allowed them to save their forces, which they later used to retake the lost ground, successfully defending Malaya Loknya, and denying Russians an opportunistic surprise breakthrough.


10,596 posted on 01/12/2025 6:52:45 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10594 | View Replies]

To: PIF; BeauBo; AdmSmith
⚡️ Trump is ready to lift restrictions on long-range weapons for Ukraine to bring Putin to the negotiating table, Waltz

Active preparations are underway for a meeting between Trump and Putin, says Michael Waltz, the incoming U.S. National Security Advisor.

Earlier, Trump himself mentioned on Fox News that plans for a meeting with Putin are underway. According to media reports, Swiss authorities have expressed their willingness to host the meeting.

https://x.com/nexta_tv/status/1878468481579892839

The putin puffers are hardest hit.

10,597 posted on 01/12/2025 9:05:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10596 | View Replies]

To: FtrPilot; PIF; gleeaikin
Кремлевская табакерка

Dugin named those in Russia who must be “absolutely and urgently executed.” The lists “have already been sent to the right places.”

Aleksandr Dugin has called several times for show trials and even executions to restore internal order in Russia. In a comment to our channel, he said who “must be punished first.” “The enemies from Meduza recently published an article about how many representatives of our elites, you see, are tired of the war (sorry, we are providing a link
[English version https://meduza.io/en/feature/2025/01/09/we-expected-the-war-to-end ] to this text by foreign agents so that it is clear what we are talking about, - ed.). It is bitter to admit, but this information is true. There are many in the elite who are tired of the war, those who do not want our Victory. We must begin the cleansing of Russia with them,” Aleksandr Gelyevich believes. He is confident that it is necessary “absolutely, urgently, and demonstratively to try and execute 10-15 such people who are tired of the war.” “Unfortunately, there will be no way around bloodshed here. After all, the war for the future of Russia will be long, and if some politicians and businessmen do not understand this, we will lose. At the same time, 10-15 people are quite enough. The rest will immediately come to their senses,” Dugin said.

According to the philosopher, “he has several specific lists of internal enemies of Russians, and these lists have already been passed on to the right places.” Where exactly, Alexander Gelyevich refused to specify, citing secrecy. We must say that the Kremlin and the security forces categorically refused to comment on this information.

https://t.me/kremlin_secrets/5159

10,598 posted on 01/12/2025 9:37:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10597 | View Replies]

To: AdmSmith

The Russians are so confident of their coming victory, they are eating each other.


10,599 posted on 01/12/2025 9:48:47 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10598 | View Replies]

"Non ci sono nazisti in Ucraina" pic.twitter.com/PcR408N2ET— Chance 🤺 Giardiniere 🍊 🔞 (@ChanceGardiner) January 12, 2025


10,600 posted on 01/12/2025 9:57:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10599 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,561-10,58010,581-10,60010,601-10,620 ... 18,981 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson