Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,021-10,04010,041-10,06010,061-10,080 ... 19,001-19,016 next last
To: blitz128; ansel12
In the American experience, the Norks would ceratinly be referred to as mercenaries.

The Hessian soldiers fighting for Britain during our Revolution have traditionally been labled as mercenaries and they were specifically referred to as such in the Declaration of Independance.

10,041 posted on 12/28/2024 8:11:38 AM PST by Mr. Lucky
[ Post Reply | Private Reply | To 10037 | View Replies]

To: Mr. Lucky

The North Korean army captives will of course be treated as POWs by Ukraine, not as mercenaries, call them an auxiliary if you want to go back to the Hessians.

If a legal soldier is a mercenary now, then what new name are we going to have to create for mercenaries?

Russia has it’s troops, it’s foreign volunteers who are part of their troops, North Korean Army soldiers, and mercenaries fighting for it.


10,042 posted on 12/28/2024 8:22:39 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 10041 | View Replies]

To: Mr. Lucky; gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; ...
According to propagandist Solovyov, Finland, Warsaw, the Baltics, Moldova, and even Alaska should be “returned to the Russian Empire.

They won't stop at Ukraine. The Russian imperialists are insatiable.

https://x.com/Gerashchenko_en/status/1872999611427967137
17 sec video

10,043 posted on 12/28/2024 10:06:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10041 | View Replies]

Russian propagandists are mocking Trump, saying the only thing he has to offer is to allow Russia to take not only Europe and the UK but also Alaska “and a bit of California.”

https://x.com/Gerashchenko_en/status/1858271202806034597

1 min video Eng sub


10,044 posted on 12/28/2024 10:17:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10043 | View Replies]

“Russia just wants to restore historical justice by capturing Finland, Poland, Baltic States and Alaska”

One of Putin's propagandists spills the beans on one of the most watched TV programs on Russian state TV. Russians are marinated in this propaganda

https://x.com/visegrad24/status/1773315738201206808
34 sec video Eng subtitles

10,045 posted on 12/28/2024 10:38:02 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10044 | View Replies]

To: AdmSmith

“Russian propagandists are mocking Trump, saying the only thing he has to offer is to allow Russia to take not only Europe and the UK but also Alaska “and a bit of California.””

Those guys need an ass kicking, real bad.


10,046 posted on 12/28/2024 12:38:15 PM PST by BeauBo
[ Post Reply | Private Reply | To 10044 | View Replies]

To: PIF

“The Spice must flow!”

It just does not necessarily have to flow from Russia anymore. Replacement supply for the Russian natural gas that will be shut off through the Druzbha Pipeline in just a few days (Happy New Year, freedom loving people of Central Europe), has already started delivery from God’s own United States of America. After more than a half century of operation, Master Strategist Putin has handed that long term stream of cash over to the USA. Thanks Vlad, you are a real sucker. Who’s your Daddy now, Fico?

“Ukraine has taken delivery of its first U.S. LNG cargo at a Greek terminal as Ukraine and Europe look to bolster their energy security by reducing their dependence on Russian gas, Ukraine’s largest private energy company, DTEK, said on Friday (27 Dec).

The delivery of approximately 100 million cubic meters of gas, or 1 TWh of energy, onboard the Gaslog Savannah arrived at the Revithoussa LNG terminal in Greece on Friday morning. D.TRADING, DTEK’s pan-European trading subsidiary, has purchased the entire cargo.

Working with Greek and other partners, the LNG will now be re-gasified and exchanged through European Union and Ukrainian gas networks, the Ukrainian company said.

“The arrival of this LNG cargo is a clear signal of DTEK’s determination to play its part in strengthening Ukraine and Europe’s energy security,” said Maxim Timchenko, chief executive of DTEK.

“Cargoes like this are not only providing the region with a flexible and secure source of power, but are further eroding russia’s influence over our energy system. We are very grateful to the United States for the strategic contribution it is making to Europe’s energy security with such shipments,” Timchenko added.

DTEK’s trading subsidiary signed in June a Heads of Agreement (HOA) with U.S. firm Venture Global for the supply of U.S. LNG to Ukraine and Eastern Europe.

The arrival of the first such U.S. LNG cargo comes days before the deal for Russian gas flows to Europe transiting Ukraine expires on December 31...

...On Thursday, Putin said that there isn’t time for a new gas transit deal to be reached between Russia and Ukraine. The Russian president was quick to add that the lack of a deal was (wait for it...) entirely Ukraine’s fault.”


10,047 posted on 12/28/2024 12:50:38 PM PST by BeauBo
[ Post Reply | Private Reply | To 10021 | View Replies]

To: AdmSmith
"Alaska should be “returned to the Russian Empire.”"

We are not even going to give them their old natural gas market share back (that they, their parents and grandparents enjoyed), much less anything else. We are taking their lunch now, and are going to keep it.

Russia is losing, and going to lose big, for what they have allowed Putin to do.

While Russia's long term, Strategic attempt to export significantly more natural gas through its new Arctic LNG 2 project has been completely shut down by sanctions, The USA has just this week opened a massive new LNG export facility (Plaquemines, in Louisiana) - one of the largest in the world.

OilPrice.com reports (28 Dec 2024):

"Exports from America's eighth liquefied natural gas facility began this week, highlighted by an LNG carrier departing for Europe. This reinforces the US' position as the world's leading LNG exporter and provides tailwinds for President-elect Donald Trump as he urges Europe to increase US energy product purchases in his upcoming second term.

Venture Global, one of the largest US LNG developers, shipped its inaugural cargo of LNG from its Plaquemines export facility in Louisiana via a company-owned carrier named "Venture Bayou." (one of the first two (with Venture Gator) of the company's nine new super tankers, just built this year)... ...

Venture Global wrote in a statement cited by Bloomberg that the Plaquemines will "produce and export LNG while construction and commissioning continue for the remainder of the project's 36 trains and associated facilities." (36 trains is huge)

Plaquemines has several long-term customers, including European utility Electricite de France SA, Polish energy firm Orlen SA, China's Sinopec and Cnooc Ltd., and Shell plc.

When the Plaquemines LNG facility becomes fully operational, expected in late 2025 or early 2026 according to Venture Global's project timeline, it will rank among the world's largest LNG export plants, further securing the US' position as the world's top LNG exporter. This development is pivotal, as US LNG has been offered to Brussels as a replacement for Russian piped NatGas.

Venture Global CEO Mike Sabel wrote in a statement: "In just five years, Venture Global has built, produced and launched exports from two large-scale LNG projects which has never been done before in the history of the industry."

The potential LNG export boom will likely please President-elect Trump, who recently threatened Europe with tariffs unless it increased its purchase of US energy products next year...

...In response to Trump's comments about the US-EU LNG trade, Goldman analysts said US LNG could "theoretically" replace piped Russian NatGas to the EU."

(American LNG export capacity, already the world's largest since 2022, is on track to more than double again, in just Trump's next term. Give you one guess whose market share we will take - Dumbo Putin's, the Doom of Russia.)


10,048 posted on 12/28/2024 3:42:41 PM PST by BeauBo
[ Post Reply | Private Reply | To 10043 | View Replies]

Victoria Nuland now on Board of the National Endowment for Democracy (NED), a CIA front group that instigates color revolutions in nations targeted for regime change & plunder.

2018: Trump slashed funding for NED. https://t.co/UB4DUNwZ6S pic.twitter.com/qLqRO5d1Mg— ⏳Towhee 🌏☮️ (@amborin) October 30, 2024


10,049 posted on 12/28/2024 3:48:28 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10038 | View Replies]

To: ansel12

Me careful the rest of the usuals deny any Norks mercs or not are fighting in Ukraine. Might end up
On the wrong end of a Meme😎


10,050 posted on 12/28/2024 3:52:46 PM PST by blitz128
[ Post Reply | Private Reply | To 10039 | View Replies]

To: blitz128
"Me careful the rest of the usuals deny any Norks mercs or not are fighting in Ukraine."

Absolutely nobody knows what this means.

10,051 posted on 12/28/2024 3:56:38 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10050 | View Replies]

To: blitz128

Resident FR TYPO monitor is on the job, well done
BE careful the rest of the usuals deny any Norks (mercs or not) are fighting in Ukraine. You might end up on the wrong end of a meme😎

I am sure the “super genius “ can figure this out if he applies his huge Melon to it
Verstehen JB?😂


10,052 posted on 12/28/2024 4:02:50 PM PST by blitz128
[ Post Reply | Private Reply | To 10050 | View Replies]

To: AdmSmith

“Russian propagandists are mocking Trump, saying the only thing he has to offer is to allow Russia to take not only Europe and the UK but also Alaska “and a bit of California.”

That reminds me of the hubristic propaganda they put out in 2022, mocking and threatening the EU, about them freezing out that Winter, if mighty Russia chose to turn off the gas. They even specifically showed the NordStream Pipeline, in their manful “shut off” sequence.

https://www.youtube.com/watch?v=pon0cIOl60w

Well now that the Nordstream Pipelines are destroyed, Yamal is long since shut down, and Druzhba is in its final days, it is so glaringly obvious how wrong the Russian propagandists, and Russian leaders, have been - just how full of crap they are.


10,053 posted on 12/28/2024 4:45:35 PM PST by BeauBo
[ Post Reply | Private Reply | To 10044 | View Replies]

To: AdmSmith

“According to propagandist Solovyov, Finland, Warsaw, the Baltics, Moldova, and even Alaska should be “returned to the Russian Empire.””

Instead, in the real world, Russia had to cut loose one more of its captive territories today - Transnistria, a narrow territory at Moldova’s eastern border with Ukraine, has been occupied by Russia since the early 1990s.

Kyiv Independent reports:

Russia officially halts gas supplies to Moldova’s Transnistria

“The Russian state-owned energy giant Gazprom announced on Dec. 28 that it is ending gas supplies to the Russian-occupied region of Transnistria in Moldova, effective Jan. 1, 2025.

While a deal to allow Russian gas to flow to Moldova and other European countries via Ukraine expires at the end of the year, Gazprom said the decision was related to Moldova’s outstanding debt, not problems with transit (to evade liability for not delivering per contract)...

...Moldovan Prime Minister Dorin Recean condemned the decision and denied Russia’s allegations of debt.

“Russia uses energy as a political weapon, turning people in the Transnistrian region, which it controls through its illegally stationed army, into hostages,” Recean said in a social media post.

“The government condemns these oppressive tactics and reiterates that it will not admit any alleged debt, which has been invalidated by an international audit.”

Recean said the Moldovan government was considering a number of legal options in response to Russia’s decision, including international arbitration.

Transnistria is heavily dependent on Russian gas. Since 2022, the roughly 2 billion cubic meters of Gazprom gas flowing to Moldova per year have been used only by the Transnistria region, while the rest of the country has switched to European supplies...

...Alternative transit routes are available for Moldova, however. Russian gas could reach the country via the TurkStream pipeline, flowing to Turkey and then through Bulgaria and Romania to Moldova.

Gazprom has rejected this option. The company announced it was limiting gas supplies to Moldova to “0 cubic meters per day,” citing breach of contract rather than transit issues.”

Crunch time. Time to kick out the remaining Russian troops (Ukraine could help, if they prefer to be shot). Send them a big bill for their lodging.

Newsweek reported (24 Dec): “(Adrian Balutel, Moldovan Preident Sandu’s chief of staff) added that resolving the territorial dispute over Transnistria would require “the complete and unconditional withdrawal of Russian troops, which are illegally stationed on the sovereign territory of the Republic of Moldova.””


10,054 posted on 12/28/2024 5:32:46 PM PST by BeauBo
[ Post Reply | Private Reply | To 10043 | View Replies]

To: blitz128; PIF

I could be wrong, but I believe mercenaries operate under different rules or agreements than regular troops, and are usually paid significantly more. Also I wonder if anyone has dared to tell Putin that around 3,000 Norks are already casualties.


10,055 posted on 12/28/2024 10:04:39 PM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 10038 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, December 28, 2024

Ukrainian forces recently struck a Russian Shahed drone storage, maintenance, and repair facility in Oryol City, Oryol Oblast. The Ukrainian General Staff reported on December 28 that Ukrainian forces struck the facility on December 26 and that the strike significantly reduced Russia’s ability to conduct Shahed strikes against Ukraine.[9] Russian opposition outlet Astra, citing unspecified sources, reported that Ukraine struck the facility with at least three Storm Shadow missiles on the afternoon of December 26 and that the strike wounded and killed nine Russian servicemembers.[10] Satellite imagery indicates that Russian forces began constructing the facility in August 2024 and may have completed construction in November or early December 2024.[11]

Russian authorities continue to establish a legal basis to remove the Taliban and Hayat Tahrir al Sham (HTS) from the Russian government’s official list of banned terrorist organizations. Russian President Vladimir Putin signed a law on December 28 allowing the Russian government to remove organizations from Russia’s list of terrorist organizations.[12] Russian milbloggers noted that the decree will facilitate Russia’s rapprochement with the Taliban, and one milblogger claimed that the Taliban has demonstrated their intentions to bring peace to Afghanistan, which will open new trade routes for Russia.[13] ISW previously observed that Russian authorities are preparing legal mechanisms to remove the Taliban from the list, and Putin’s decree is likely one of the final steps in this process.[14] Putin’s decree also establishes a legal basis for the Russian government to remove other organizations, including HTS, from its list of banned terrorist organizations as part of Russia’s efforts to develop positive relations with the HTS-led interim government in Syria and secure guarantees for the continued operations of Russia’s military bases in Syria.
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-28-2024


10,056 posted on 12/29/2024 3:42:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10014 | View Replies]

To: BeauBo
28DEC2024 Putin Ally Calls for Alaska's Return to Russia

Tensions around Russia and Alaska intensified in January 2024 when reports surfaced that Putin was looking into reobtaining Alaska, reviving an effort pushed by Russian media throughout the ongoing war in Ukraine that Moscow could seize the state.

Tensions remain high between North Atlantic Treaty Organization (NATO) and Russia amid the Russian-Ukraine war as NATO leaders have increasingly warned that direct conflict with Moscow is a realistic danger. This comes after Putin and senior Russian officials have repeatedly threatened nuclear escalation against Kyiv and its Western partners since Russia launched its full-scale invasion of Ukraine in February 2022.

During the recent program, Solovyov said Finland, Warsaw, the Baltics, Moldova, and Alaska should be “returned to the Russian Empire.””Do you think I'm joking when I mention Finland, Warsaw, the Baltics, Moldova? Everything returned to the Russian Empire. And Alaska too, while you're at it,” Solovyov said in a translated video.
Deputy chairman of the Security Council of Russia Dmitry Medvedev joked about Alaska in January on X, teasing that “war is unavoidable,” since the State Department said Russia was not getting Alaska back. He added a laughing emoji to the post.

Keir Giles, a senior consulting fellow at Chatham House, previously told Newsweek: “Continued Russian approaches toward U.S. airspace are a reminder that while the bulk of Russia's land forces are tied down in Ukraine, its air and naval forces continue to pose a global threat to its adversaries including the United States. “It's another indicator that Russia is readying itself for confrontation with the West beyond Ukraine, and any break in the fighting there - for instance through a ceasefire - will allow Russia to reconstitute its forces even faster without Ukraine destroying them almost as fast as they are rebuilt.

https://www.newsweek.com/vladimir-solovyov-calls-alaskas-return-russia-2006979

10,057 posted on 12/29/2024 3:55:33 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10054 | View Replies]


10,058 posted on 12/29/2024 3:58:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10015 | View Replies]

1,730 i.e. more than 1.20 Russians and Norks/min


10,059 posted on 12/29/2024 4:04:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10016 | View Replies]

To: gleeaikin

My point was not really about the definition legal or otherwise of mercenary, but the point that from the beginning of this most recent invasion and war. The Russians and the usuals ( repeating myself in many cases) were all about how Russia was self sufficient.
They had all the resources and industrial capacity to win this war and bring Ukraine to its knees.

Now almost 3 years into this and Russia is dependent on China, Iran, NK, and sanction busting for weapons, ammunition, and equipment to sustain their “SMO”.
Moreover they need manpower from the rest of the world, first through worldwide recruiting of mercs, and now from NK

The later must really sting when so many of the usuals still declare that no NKs are fighting in Russia or even there at all.


10,060 posted on 12/29/2024 4:20:32 AM PST by blitz128
[ Post Reply | Private Reply | To 10055 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,021-10,04010,041-10,06010,061-10,080 ... 19,001-19,016 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson