Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: Paal Gulli

The Orkney people were unique in one other way. In the rest os Britain the population was replaced with male DNA from the continent and mated with original female DNA from the native Britons. In Orkney it was the other way around.


7 posted on 10/19/2024 5:59:41 AM PDT by JeanLM
[ Post Reply | Private Reply | To 4 | View Replies ]


To: JeanLM; SunkenCiv

Map showing the proportions of Scandinavian and British/Irish ancestry for mtDNA (Mt) and Y-chromosomes (Y) for each of the admixed populations from the North Atlantic region included in this study. The Scottish island groups of Shetland, Orkney, the Western Isles and Skye, and the region that we define as the ‘North and West coast of Scotland’, are encircled for clarity.


Major events in the population history of the British Isles. Source: https://www.nature.com/articles/nature14230

https://stetson.substack.com/p/the-genetic-history-of-the-british

https://www.researchgate.net/figure/Map-showing-the-proportions-of-Scandinavian-and-British-Irish-ancestry-for-mtDNA-Mt-and_fig1_7920315

The search continues.

8 posted on 10/19/2024 9:59:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson