Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

First genetic clue why some people do not get sick from COVID-19
Japan Times ^ | July 20, 2023 | Staff

Posted on 07/20/2023 11:03:40 AM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-55 last
To: Grampa Dave

Cruise ship with 3711 passengers quarantined off the coast of Japan for ~ 2 weeks. Only 19%+ infected(712). All passengers isolated in their rooms.

Odd circumstances, there were multiple instances where one member of a cabin pair (husband and wife, usually) got seriously ill while the other did not only not get ill they did not test positive either. Very similar to what you referenced regarding family members.

It implied there was either partial or pre-existing immunity. Death count reporting varied from 7 to 14 all older with comorbidities.

“Diamond Princess proved that the claim, which continues to be made today, that (1) this virus is extremely deadly and (2) there is zero cross or innate immunity were both false. It is not possible for a very transmissible respiratory virus to infect one person in a quarantined cabin of two people, while the other does not get sick at all unless either (1) the second person is already immune or (2) the second person gets it but has no symptoms at all and recovers before being tested, and thus tests negative.”

https://market-ticker.org/cgi-ticker/akcs-www?singlepost=3537309

This was early 2020


41 posted on 07/20/2023 6:47:15 PM PDT by Polynikes (Nicht geimpft Mensch 2nd Klasse)
[ Post Reply | Private Reply | To 39 | View Replies]

To: Red Badger

“Coffee in general has gone downhill across all brands, IMHO.”

At 6:30 am our Cuisinart coffee maker grinds the fresh coffee beans, and it is ready to drink in minutes.

Whoever is up first pours a cup, for their use and brings a cup with a lid to the one left in bed.

That 8 cup of heavenly brew is enough for these two olden ones.


42 posted on 07/20/2023 7:05:29 PM PDT by Grampa Dave (,We have number of experts, stating B$ as fact, & they have no idea nor reality or solutions!!)
[ Post Reply | Private Reply | To 16 | View Replies]

To: Polynikes

Thanks for this link.

My wife reminded me that one of my female siblings and some 0f her off spring and female grandkids and this sibling never got a serious Covid infection. Yet, their spouses often got hit hard.

There is a joker in this group of people, (young previously healthy 18~50+ women) seem prone to the long term Covid.


43 posted on 07/21/2023 10:25:28 AM PDT by Grampa Dave (,We have number of experts, stating B$ as fact, & they have no idea nor reality or solutions!!)
[ Post Reply | Private Reply | To 41 | View Replies]

To: Grampa Dave

“There is a joker in this group of people, (young previously healthy 18~50+ women) seem prone to the long term Covid.”

Were a lot of them health care workers by chance?


44 posted on 07/21/2023 11:33:28 AM PDT by Polynikes (Nicht geimpft Mensch 2nd Klasse)
[ Post Reply | Private Reply | To 43 | View Replies]

To: Polynikes

“Were a lot of them health care workers by chance?”

None, except my wife, who retired as an RN over a decade ago.


45 posted on 07/21/2023 12:17:17 PM PDT by Grampa Dave (,We have number of experts, stating B$ as fact, & they have no idea nor reality or solutions!!)
[ Post Reply | Private Reply | To 44 | View Replies]

To: Red Badger; StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; ...

46 posted on 07/21/2023 11:20:17 PM PDT by SunkenCiv (Politics do not make strange bedfellows, and the enemy of your enemy may still be your enemy.)
[ Post Reply | Private Reply | View Replies]

To: Wuli

I tested positive for Covid twice, seven months apart. Had to be tested before medical procedures could be conducted. I had no symptoms whatsoever. Never got the jabs either. The day before I tested positive on one of the tests, I’d gone to the dentist to get my teeth cleaned. They were still checking temperatures back then, and mine was normal.


47 posted on 07/21/2023 11:36:13 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Track9
"I attribute my success at being china virus free to not owning a TV."

LOL! I own a TV, but I don't watch any news programs on any platform. Haven't since 2008.

48 posted on 07/21/2023 11:37:59 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Grampa Dave
"The women I noted in my response #8 below, not getting Covid in spite of living with those who did, were/are descendants of the upper UK and Western Europe."

Same here. That's where about 50 percent of my DNA comes from. Tested positive for Covid twice with no symptoms.

49 posted on 07/21/2023 11:39:21 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 12 | View Replies]

To: ryderann
"Perhaps it was the genes from my mother’s Swedish/German/Viking forebears that saved me from covid."

I got some of those too. Sweden, Denmark, and Germanic Empire. My parents never knew any of that. 50% is mostly England, Wales, with a little Scotland, Ireland, and France. My Dad was born in Holland so I have DNA from there and Belgium. My mother was born in Canada.

50 posted on 07/21/2023 11:44:49 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Grampa Dave
"There is a lot of fairly good data on protection after a Shingles shot."

Hadn't heard that. I had the first Shingles shot, then they recommended the double Shingrix, so I got those back in 2019. Never got the covid shots, and I'm done with flu shots too.

51 posted on 07/21/2023 11:50:10 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 40 | View Replies]

To: Red Badger; SunkenCiv
Out of that group, 136 saw no COVID-19 symptoms two weeks before and after testing positive. One in five of that group carried at least one copy of an HLA variant called HLA-B*15:01. Those fortunate enough to have two copies of the gene — one from their mother, one from their father — were over eight times more likely to be asymptomatic from COVID-19 than other people, the study said.

It is not that easy, either Scylla or Charybdis:

The human leukocyte antigen (HLA) haplotype DRB1*15:01 is the major risk factor for multiple sclerosis (MS).

https://www.nature.com/articles/s41467-018-04732-5

52 posted on 07/22/2023 12:04:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ryderann

That looks like the same mix that my husband has. He did not get COVID.

I, on the other hand, almost died. Looking at our general DNA we are almost identical percentage-wise. He has more Nordic.


53 posted on 07/22/2023 6:49:11 AM PDT by madison10
[ Post Reply | Private Reply | To 15 | View Replies]

To: mass55th

“There is a lot of fairly good data on protection after a Shingles shot.”

When my wife and I went to get our shingles shots, the nurse, a retired Navy nurse, recommended that we not get the shots at the same time.

My wife like I only got the first 2 shots and no more as the data re side effects and worse came in.


54 posted on 07/22/2023 8:16:48 AM PDT by Grampa Dave ( We have number of experts, stating B$ as fact, & they have no idea nor reality or solutions!!)
[ Post Reply | Private Reply | To 51 | View Replies]

To: ryderann

I’m a Scots/Irish/Welsh/Danish/Norwegian mutt.
My area is heavily populated by all of the above plus Austrian and German descendants of coal miners.
I’m just across the river from WV, where my doctor is and the people there are pretty much the same as here, being barely a mile away.
Every year we all get the “WV crud” which is some kind of mild, extremely short lived mystery “cold” that barely lasts a day.
It’s my belief that is why “Covid” skipped us over.
We’re already naturally “inoculated” against yearly shifting coronavirus crap.

Still, I did watch some fellow hillbillies panic and submit to those jabs.

I’m embarrassed for them.

They have forgotten the face of their fathers.


55 posted on 07/22/2023 12:46:24 PM PDT by Salamander (Please visit my profile page help save my beloved dog's life. https://www.givesendgo.com/G2FUF)
[ Post Reply | Private Reply | To 15 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-55 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson