[Pelham]

GP120 is the “envelope glycoprotein” of HIV.

The paper you found and linked to is about the “surface glycoprotein” of the SARS2 virus.

Could you point to where in that paper you see GP120 mentioned as being part of the SARS2 surface glycoprotein?

[Steve Van Doorn]

said, "Could you point to where in that paper you see GP120 mentioned as being part of the SARS2 surface glycoprotein?"

I shouldn't have given the BLAST. Though i will give it a try.
What you do is first look at HIV-1 and compare it to SARS-Cov-2 the whole genome
On the Genome of HIV and click on "FASTA" on the upper left of page: Now look for
" ATGGCAGTATTTGTTCACAATT "
within this page of HIV-1
https://www.ncbi.nlm.nih.gov/nuccore/AF422215.1

Now go to the SARS-Cov-2 the whole genome on this page.
" ATGGCAGTTTTTGTACACAATT " which according to Luc Montagnier and jean-claude Perez is 91% homology (similarity)
https://www.ncbi.nlm.nih.gov/nuccore/LR757998.1#sequence_LR757998.1

Which according to Montagnier and Perez they cited this report which is an "Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag" Which are fragments of HIV
Here:
https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1

To answer your question gp120 gene is the outer surface of the glycoprotein from HIV.

All found in this report from July 2020:
https://www.researchgate.net/publication/342926066_COVID-19_SARS_and_Bats_Coronaviruses_Genomes_Peculiar_Homologous_RNA_Sequences_Jean_Claude_perez_Luc_Montagnier