Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: nuconvert; BeauBo; blitz128
Iran Update Special Report, April 23, 2026

US President Donald Trump's messages have appeared to elicit a choreographed response by the Iranian regime that is directed both to regime factions and to the United States. The choreographed response was an attempt to portray unity between the “moderate” and “hardliner” factions in the regime by stating the same message affirming belief in the Islamic Revolution's core values. Trump stated on Truth Social on April 23 that Iran is “having a hard time figuring out who their leader is.”[1] Trump highlighted infighting between the regime's “moderate” and “hardliner” factions, adding that the United States will maintain the blockade on Iranian ships and ports until the regime is “able to make a deal.”[2]

The heads of Iran's three branches of government–Iranian President Masoud Pezeshkian, Judiciary Chief Gholam Hossein Mohseni Ejei, and Parliament Speaker Mohammad Bagher Ghalibaf–issued a series of statements aimed at defending themselves from accusations of “moderation” in the Islamic Revolutionary context. Pezeshkian, Ejei, and Ghalibaf published nearly identical messages on X on April 23 in which they emphasized their allegiance to the principles of the Islamic Revolution.[3] All three leaders rejected that the regime contains “hardline” and “moderate” factions and circulated the slogan “One God, one nation, one leader, and one path—the path of victory for Iran.” Ejei published the statement first, followed by Pezeshkian and Ghalibaf. Ejei, while a hardliner historically, allied with the pragmatic Iranian leaders during efforts to end the 12-Day War.[4] Iranian Foreign Affairs Minister Abbas Araghchi, who, along with Ghalibaf, has been leading Iran's negotiating delegation, posted a similar message on X in which he emphasized the regime's unity.[5] Senior IRGC commanders such as Vahidi and SNSC Secretary Mohammad Bagher Zolghadr did not circulate similar statements, but other IRGC-affiliated figures did several hours after Pezeshkian, Ejei, and Ghalibaf’s messages (see more below).

The publication of these messages and the context of the events surrounding them indicate that Pezeshkian, Ghalibaf, Ejei, and Araghchi likely sought to defend themselves from accusations of moderation, which Vahidi could use to challenge their commitment to the revolution. Araghchi, Ghalibaf, and Pezeshkian have adopted a more pragmatic approach toward the United States in negotiations, a stance that Vahidi and those close to him likely view as a diversion from the ideals of the Islamic Revolution. Vahidi attempted to insert Zolghadr into the first round of negotiations with the United States in Pakistan despite the protests of Araghchi and Ghalibaf.[6] Vahidi almost certainly did this to ensure that someone from his inner circle could keep tabs on whether Araghchi or Ghalibaf tried to negotiate outside of Vahidi’s red lines, which include maintaining support for the Axis of Resistance, recognizing Iran's “right” to enrich uranium, and preserving Iran's “control” over the Strait of Hormuz. US officials told Axios on April 20 that the US negotiating delegation thought it was “negotiating with the right people“ in Islamabad on April 11 and 12, but that the IRGC effectively told the Iranian negotiating delegation upon their return to Tehran that the negotiating team ”[does not] speak for” the IRGC.[7] Ghalibaf publicly defended the approach of negotiating with the United States in a speech on April 18 and criticized hardline officials–including SNSC member Saeed Jalili and hardline parliamentarian Amirhossein Sabeti–for their opposition to negotiations during a meeting with advisers.[8] ISW-CTP previously assessed that Ghalibaf’s criticism was likely implicitly aimed at Vahidi because Vahidi also opposes negotiating with the United States.[9]

Iranian Supreme Leader Mojtaba Khamenei acknowledged Ghalibaf, Pezeshkian, Ejei, and Aragchi’s obeisance several hours later in a choreographed manner that likely seeks to demonstrate unity and signal an end to the internal competition between pragmatic and hardliner officials. Mojtaba suggested that the statements represented a spontaneous unification of the regime's divided factions and portrayed this unification as a direct response to Trump's statement. ISW-CTP has rendered Mojtaba’s statement in English below:

“Due to the extraordinary unity forged among our compatriots, a fracture has appeared within the enemy. With active gratitude for this blessing, our cohesion will become stronger and more ironclad, and the enemies will be further humiliated and disgraced. The enemy media operations, by targeting the minds and souls of the people, aim to undermine national unity and security; May this evil intention not be realized due to our negligence.”[10]

IRGC-affiliated Tasnim News Agency portrayed the messages solely as a response to recent comments from Trump.[11] It is not clear who is writing Mojtaba’s online messages, given that he is in poor physical condition (see below).

A number of IRGC and IRGC-affiliated regime figures posted similar statements hours after the “moderates’” statements to express agreement with and support for Mojtaba’s position. These messages present an apparent unified front against the United States. But they also allow the IRGC to deflect attempts by pragmatists to blame the IRGC or hardliners if war resumes by spreading the blame across the entirety of the ”unified” government. Figures like IRGC Aerospace Commander Brigadier General Majid Mousavi, former SNSC Secretary Ali Akbar Ahmadian, IRGC Quds Force Commander Brigadier General Esmail Ghaani, and Artesh Commander Major General Amir Hatami posted messages affirming the “One God, one nation, one leader, and one path” message and unity against the United States.[12]

Iranian Supreme Leader Mojtaba Khamenei is likely unable to seriously impact Iranian decision-making due to injuries sustained during the war, however. The New York Times reported on April 23 that Mojtaba is under frequent medical attention and heavily reliant on the advice and guidance of senior IRGC commanders led by Vahidi, citing a number of former IRGC and current regime officials.[13] One adviser to former Iranian President Mahmoud Ahmadinejad stated that Mojtaba is running the country like it is a company board, with the senior IRGC commanders as the members of the board. The report noted that regime officials have difficulties communicating with Mojtaba, including because they needto send messages secretly and via multiple runners. The article also noted that Mojtaba has been heavily influenced by IRGC commanders due to his close historical ties with them from the Iran-Iraq War. Supreme Leader Military Affairs Adviser Major General Yahya Rahim Safavi has reportedly served as Mojtaba’s top military adviser, as he did with Mojtaba’s father, Ali Khamenei. The New York Times report is consistent with ISW-CTP’s assessment at the time of Mojtaba’s assumption of power that he would likely be influenced by the more hardline elements of the Iranian regime due to his close ties to them.[14]

Vahidi continues to support Iranian sovereignty over the Strait of Hormuz and efforts to retain the nuclear program, because he views negotiations with the United States as having no present value, according to IRGC sources and anti-Iranian regime media.[15] An IRGC‑affiliated outlet argued on April 22 that negotiations over the Strait of Hormuz are “unnecessary” because such negotiations would signal doubt over Iran's sovereignty over the Strait of Hormuz.[16] The same outlet stated that negotiations under these conditions would grant the United States a low‑cost victory and violate declared red lines, particularly on Iran's nuclear file and “regional cooperation,“ which is likely a euphemism for the Axis of Resistance.[17] Senior Iranian parliamentarians broadly echoed this hardline posture on April 22 and 23 by portraying negotiations as damaging to deterrence and acceptable only under tightly constrained, Iranian‑defined terms.[18] Anti-regime media reported on April 23 that Mojtaba’s office, which Vahidi appears to run, opposed the discussion of the nuclear issue.[19] Araghchi reportedly contended that, under the Supreme Leader's orders, participation in negotiations offers little benefit and effectively amounts to a “death sentence” for the talks.[20] Vahidi and several other generals reportedly did not see the point in negotiating with the United States because the US naval blockade of Iran demonstrated that US President Donald Trump was not interested in negotiations and instead sought to pressure Iran to surrender, according to officials and two members of the IRGC briefed on the meeting who spoke to the New York Times on April 23.[21] Pakistani officials told Saudi media on April 23 that Iran-Pakistan contact continues, but confirmed that discussions are stalled due to Iranian opposition to the US naval blockade.[22] The officials noted that Iran has not formally responded to the possibility of future talks.[23] These reports of Vahidi’s unwillingness to negotiate are consistent with ISW-CTP’s April 22 assessment that Vahidi is deliberately accepting the risk of potential US military response to assert Iranian ”control” over the Strait of Hormuz.[24]

Vahidi is part of the first generation of revolutionaries, and he prioritizes ideological purity and hard power over the economy and well-being of Iranian citizens. The regime figures who appear more pragmatic and are concerned with the economy — Pezeshkian and Ghalibaf — also appear to have accepted Vahidi’s positions in pursuit of unifying the Iranian political class.[25] Pezeshkian and Araghchi disagreed with Vahidi and other IRGC officials’ view that talks are pointless, according to officials and two members of the Guards briefed on the meeting who spoke to the New York Times on April 23.[26] Pezeshkian also warned that financial gains from negotiations — likely in reference to the lifting of the naval blockade, sanctions relief, and the unfreezing of Iranian assets abroad — are needed to pay for the estimated $300 billion in losses from war with the United States and Israel.[27] Vahidi and the IRGC dismissed Pezeshkian’s concerns over the economy, as they have done since the start of the war, according to anti-regime media.[28] Vahidi almost certainly gives precedence to ideological orthodoxy and hard power over ideological flexibility that would present the sort of agreement that would dampen economic challenges. Hard power, in this logic, is essential for the Iranian regime's control over Iran from both internal and external threats. Economic distress remains one of the regime's most significant internal vulnerabilities, as demonstrated by the December 2025–January 2026 protests.[29] Ideologically orthodox revolutionaries who prioritize hard power believe that such vulnerabilities can be guarded against through force.

https://understandingwar.org/research/middle-east/iran-update-special-report-april-23-2026/


1,946 posted on 04/24/2026 12:34:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1943 | View Replies ]


To: nuconvert
Iran's Supreme Leader Is Mentally Sharp. He Just Can't Run a Ceasefire.

Brigadier General Salar Velayatmadar — an IRGC commander who sits on Parliament's National Security and Foreign Policy Committee, which means he is not a fringe figure but a senior official with formal oversight responsibilities — offered what remains the only official acknowledgment that a deliberate media blackout exists. “Based on the opinion of scholars in Najaf, Qom and Mashhad and the decision of security officials,” he told Iran International, “no new images or materials of him will be released for now so that enemies cannot harm him through particular methods and occult sciences,” adding that such sciences are studied at institutions “including those in Tel Aviv.”

This statement deserves parsing not for its supernatural content but for its bureaucratic architecture. Velayatmadar cited three sources of authority for the media ban: religious scholars across three seminary cities (Najaf, Qom, Mashhad — notably spanning Iraqi and Iranian institutions), unnamed “security officials,” and an implied Israeli threat vector that he chose to describe in occult rather than intelligence terms. The layered sourcing suggests not a spontaneous remark but a prepared position, an official line distributed to IRGC-aligned officials for use when the absence question becomes unavoidable, which — forty-six days in, with CNN running AI-generated deepfake analysis and Time magazine headlining “Iran's Supreme Leader No Longer Reigns Supreme” — it has.

What Velayatmadar did not explain is how a Supreme Leader who cannot be shown, heard, or visited by his own military commanders can exercise the constitutional functions that Article 110 assigns exclusively to his person: supreme command of the armed forces, declaration of war and peace, and the resolution of disputes between branches of government. The occult sciences rationale covers the media absence; it does not cover the operational absence, and the two are not the same problem.

Because Article 110 vests supreme command in the Supreme Leader as a person, not a position. Without a leader who can meet commanders, issue verbal directives, and respond in real time, no subordinate official — not the President, not the Foreign Minister — can make commitments the IRGC is constitutionally bound to honour. The authority cannot be delegated downward; it can only be absent.

The authorization ceiling — the structural inability of any Iranian official below the Supreme Leader to make ceasefire commitments that the IRGC will honour — has been analysed extensively in these pages as a governance problem: Pezeshkian’s zero authority over the military under Article 110, the IRGC’s repeated overrides of Foreign Ministry positions (most dramatically when Araghchi declared Hormuz “completely open” on April 17 and was reversed within hours by IRGC joint command), and the Supreme National Security Council's effective capture by IRGC-aligned figures including Vahidi and Zolghadr. All of that analysis remains correct. What the NYT report adds is the missing causal layer: these aren't features of the system working as designed — they are symptoms of the system operating without its capstone.

Mojtaba Khamenei cannot summon commanders because visitors risk exposing his location to Israeli tracking. He cannot issue verbal directives because his burns make speaking difficult. He cannot respond in real time because his communication travels by motorcycle. And he lacks the accumulated relational authority that made his father's directives self-enforcing — the IRGC commanders who obeyed Ali Khamenei did so not only because of Article 110 but because they had spent decades inside a relationship of mutual obligation and tested loyalty that his fifty-six-year-old son, whose pre-war career was spent as a behind-the-scenes liaison and Basij controller, has not had time to build.

Mojtaba’s constitutional name provides cover for decisions the IRGC has already made without him; invoking Article 111 would retroactively delegitimise those decisions, trigger an Assembly of Experts process the IRGC cannot fully control, and create a Provisional Council that gives President Pezeshkian — explicitly excluded from actual power — one-third of Supreme Leader authority on paper.

Article 111 of the Iranian constitution provides explicitly for the scenario the country is now living through: “Whenever the Leader becomes incapable of fulfilling his constitutional duties, or loses one of the qualifications mentioned in Article 5 and Article 109, or it becomes known that he did not possess some of the qualifications initially, he will be dismissed.” In the interim, a Provisional Council of three — the President, the Head of the Judiciary, and one jurist from the Guardian Council — assumes leadership. The Assembly of Experts (now reduced from 88 members after the building housing it was destroyed, with eight members having boycotted the online vote that installed Mojtaba) has the constitutional authority to determine incapacitation and appoint a replacement.

read the article https://houseofsaud.com/mojtaba-khamenei-authorization-ceiling/

The Constitution of the Islamic Republic of Iran
Adopted on: 24 Oct 1979
Effective since: 3 Dec 1979
Amended on: 28 July 1989
ICL Document Status: 1992

Article 110 [Leadership Duties and Powers]

(1) Following are the duties and powers of the Leadership:
1. Delineation of the general policies of the Islamic Republic of Iran after consultation with the Nation's Exigency Council.
2. Supervision over the proper execution of the general policies of the system.
3. Issuing decrees for national referenda.
4. Assuming supreme command of the Armed Forces.
5. Declaration of war and peace and the mobilization of the Armed Forces.
6. Appointment, dismissal, and resignation of:
a. the religious men on the Guardian Council,
b. the supreme judicial authority of the country,
c. the head of the radio and television network of the Islamic Republic of Iran,
d. the chief of the joint staff,
e. the chief commander of the Isalmic Revolution Guards Corps, and
f. the supreme commanders of the Armed Forces.
7. Resolving differences between the three wings of the Armed Forces and regulation of their relations.
8. Resolving the problems which cannot be solved by conventional methods, through the Nation's Exigency Council.
9. Signing the decree formalizing the election of the President of the Republic by the people. The suitability of candidates for the Presidency of the Republic, with respect to the qualifications specified in the Constitution, must be confirmed before elections take place by the Guardian Council, and, in the case of the first term of a President, by the Leadership. 10. Dismissal of the President of the Republic, with due regard for the interests of the country, after the Supreme Court holds him guilty of the violation of his constitutional duties, or after a vote of the Islamic Consultative Assembly testifying to his incompetence on the basis of Article 89.
11. Pardoning or reducing the sentences of convicts, within the framework of Islamic criteria, on a recommendation from the Head of judicial power.
(2) The Leader may delegate part of his duties and powers to another person.

Article 111 [Leadership Council]

(1) Whenever the Leader becomes incapable of fulfilling his constitutional duties, or loses one of the qualifications mentioned in Articles 5 and 109, or it becomes known that he did not possess some of the qualifications initially, he will be dismissed. The authority of determination in this matter is vested with the experts specified in Article 108.
(2) In the event of the death, or resignation or dismissal of the Leader, the experts shall take steps within the shortest possible time for the appointment of the new Leader. Until the appointment of the new Leader, a council consisting of the President, head of the judiciary power, and a religious men from the Guardian Council, upon the decision of the Nation's Exigency Council, shall temporarily take over all the duties of the Leader. In the event that, during this period, any one of them is unable to fulfil his duties for whatsoever reason, another person, upon the decision of majority of religious men in the Nation's Exigency Council shall be elected in his place.
(3) This council shall take action in respect of items 1, 3, 5, and 10, and sections d, e and f of item 6 of Article 110, upon the decision of three-fourths of the members of the Nation's Exigency Council.
(4) Whenever the leader becomes temporarily unable to perform the duties of leadership owing to his illness or any other incident, then during this period, the council mentioned in this article shall assume his duties.

https://hrlibrary.umn.edu/research/iran-constitution.html

If you're going to live like it's the Middle Ages, you might as well go all out.

1,947 posted on 04/24/2026 3:28:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1946 | View Replies ]

To: AdmSmith

“Vahidi’s red lines, which include maintaining support for the Axis of Resistance, recognizing Iran’s “right” to enrich uranium, and preserving Iran’s “control” over the Strait of Hormuz”

Sounds like someone needs killing.

Alternatively, he might be useful for a short time, since he is so predictable, if we want someone to drive the regime over the cliff a little further, for a full regime change end state.

Anyway, the resumption of bombing seems to be only a matter of time. He is really asking for it. It might be hard to make it a surprise.


1,949 posted on 04/24/2026 8:01:34 AM PDT by BeauBo
[ Post Reply | Private Reply | To 1946 | View Replies ]

To: nuconvert; gleeaikin; BeauBo; blitz128
Iran Update Special Report, April 24, 2026

Islamic Revolutionary Guards Corps (IRGC) Commander Brigadier General Ahmad Vahidi and his inner circle have repeatedly blocked attempts by Parliament Speaker Mohammad Bagher Ghalibaf and other “pragmatist” officials to push the regime toward a more flexible negotiating position. Vahidi appears to have prevailed in this internal power struggle and will likely shape the regime's approach toward negotiations and the war with a maximalist and uncompromising stance. Ghalibaf likely lacks the leverage to alter this trajectory in a meaningful way at this time. ISW-CTP has observed and reported on a sustained intra-regime rivalry between Vahidi and his inner circle and a “pragmatist” bloc that includes Ghalibaf, President Masoud Pezeshkian, and Foreign Affairs Minister Abbas Araghchi since late March.[1] The rivalry has shown significant divergences between the two blocs over how to approach the war and negotiations. The divergences first surfaced around March 28 when Pezeshkian criticized the IRGC’s actions in the war. Pezeshkian subsequently accused Vahidi and Khatam ol Anbia Central Headquarters Commander IRGC Brigadier General Ali Abdollahi Ali Abadi of “acting unilaterally and fueling escalation.”[2] The United States and Iran agreed to a ceasefire on April 7 after Araghchi reportedly persuaded the IRGC to accept it, which suggests that Vahidi disapproved of the ceasefire and, likely, negotiations. Vahidi and his inner circle then took steps to constrain the authority of Iran's negotiating team, which included Ghalibaf and Araghchi, by attempting to insert Supreme National Security Council (SNSC) Secretary Mohammad Bagher Zolghadr into the delegation and limit its mandate, particularly regarding Iran's missile and nuclear programs.[3] ISW-CTP previously assessed that Vahidi almost certainly attempted to insert Zolghadr into the delegation to ensure that someone from his inner circle could keep tabs on whether Araghchi or Ghalibaf tried to negotiate outside of Vahidi’s red lines.[4] Zolghadr accused Ghalibaf and Araghchi of showing flexibility on certain issues during negotiations in Islamabad on April 11 and 12, after which IRGC leaders called the delegation back to Tehran.[5] The talks collapsed without an agreement, and reports emphasized that the Iranian negotiating team lacked the authority to finalize an agreement.[6] Vahidi continued to reject “pragmatist” efforts to ease tensions with the United States after the first round of negotiations. The IRGC harshly criticized Araghchi after he announced that the Strait of Hormuz was “completely open” on April 17, and the IRGC Navy subsequently attacked several commercial vessels and declared that no vessels of “any type or nationality” were permitted to transit through the strait, for example.[7] Recent US-Iran talks that were expected to take place on April 21 or 22 before the ceasefire expired were canceled due to regime infighting and likely an effort by Vahidi and his camp to derail the talks. Vahidi has consolidated power throughout this rivalry while the “pragmatist” faction has lost influence over regime decision-making.

Vahidi appears to have prevailed over Ghalibaf at this time. Officials from various factions issued coordinated statements on April 23 and 24 that emphasized unity and reaffirmed revolutionary principles.[8] Ghalibaf, Pezeshkian, Araghchi, and Judiciary Chief Gholam Hossein Mohseni Ejei started this messaging, followed by figures aligned with the hardline camp, including Supreme Leader Mojtaba Khamenei, Zolghadr, IRGC Quds Force Commander Brigadier General Esmail Ghaani, and ultra-hardline politician Saeed Jalili.[9] The participation of “pragmatist” figures in this display of unity behind “revolutionary” principles indicates that they have, at least for now, accepted Vahidi’s dominance.

Recent reports that Ghalibaf may resign from being a member of the negotiating team are consistent with ISW-CTP’s assessment that Vahidi has emerged as the winner of the intra-regime rivalry.[10] Sources told Western media that Ghalibaf has grown frustrated with internal divisions and has considered resigning from the negotiating delegation, while some outlets have claimed that Ghalibaf has already resigned from the negotiating team due to disagreements over nuclear concessions.[11] The latter reports are consistent with reports that the Iranian negotiating delegation discussed the nuclear issue “contrary to instructions from Tehran” during the first round of negotiations. Ghalibaf’s resignation, if confirmed, would further signal his defeat and reduce the pragmatists’ influence over negotiations, as well as further consolidate Vahidi’s position within the regime.

“Pragmatist” officials may continue to advocate for a more flexible approach, but their efforts are unlikely to meaningfully shape regime decision-making in the near term. Some senior Iranian officials reportedly signed a secret letter to Mojtaba in recent days, warning that Iran's economic crisis is unsustainable and that serious negotiations with the United States over Iran's nuclear program are unavoidable, according to unspecified individuals familiar with the matter speaking to an Iranian journalist and media executive.[12] The signatories of the letter reportedly included Ghalibaf, Pezeshkian, Araghchi, and Mostafa Pourmohammadi. Pourmohammadi is a hardline politician and cleric from Qom who has served in several positions in the regime.[13] Pourmohammadi implied in May 2025 that he supported US-Iran talks.[14] Repeated failed efforts by this camp to shift policy suggest that the “moderate” or “pragmatist” camp has lost influence over regime decision-making for at least the time being, however.

Vahidi’s apparent victory will likely have significant implications for potential future US-Iran negotiations. His camp supports maximalist demands that are irreconcilable with stated US demands.[15] Vahidi prioritizes ideological consistency and hard power, and he views concessions as incompatible with the principles of the Islamic Revolution. Vahidi’s rejection of certain concessions and control over the scope of talks reflects this view. Iran will likely adopt positions that do not align with stated US demands if Vahidi continues to dominate decision-making.

Vahidi has also shown greater willingness than “pragmatist” officials to accept the risk of renewed conflict with the United States. ISW-CTP previously assessed that the IRGC’s actions in the Strait of Hormuz suggest that Vahidi and individuals close to him have accepted the risk of incurring a potential US military response in order to assert Iranian “control” over the strait.[16] IRGC-affiliated media has also recently signaled readiness for renewed hostilities, and Iranian military preparations have reportedly intensified.[17] Senior officials have also warned of a high likelihood of renewed conflict.[18] The ostentatious Farsi-language show of regime unity behind “revolutionary principles” is likely part of an effort to prepare the Iranian people for a return to war under an ostensibly unified government, as ISW-CTP has previously assessed.[19]

Iran and the United States are both sending delegations to meet with Pakistani mediators in Islamabad this weekend, but it remains unclear whether the delegations will engage in a second round of negotiations at the time of this writing.[20] Iranian Foreign Affairs Minister Abbas Araghchi arrived in Islamabad on April 24 for talks with Pakistani mediators.[21] Araghchi stated that the purpose of his trip is to “discuss bilateral relations and regional cooperation.”[22] IRGC-affiliated media, as well as Pakistani sources and an unspecified Iranian source speaking to Western media, emphasized that Araghchi will not negotiate with US officials while in Islamabad.[23] Ghalibaf is notably not part of the Iranian delegation despite leading the Iranian delegation during the first round of negotiations in Islamabad on April 11 and 12.[24] Araghchi stated that he will travel to Oman, which has historically mediated between Iran and the United States, and Russia after his visit to Islamabad.[25] Araghchi’s planned trip to Russia comes as the Iranian regime is preparing for a potential resumption of conflict (see above).[26] The White House confirmed on April 24 that US Special Envoy to the Middle East Steve Witkoff and Jared Kushner will travel to Islamabad on April 25.[27] White House Press Secretary Karoline Leavitt stated that “the Iranians want to talk” and “they want to talk in person, and the president is always willing to give diplomacy a chance.”[28] Leavitt added that “we have certainly seen some progress from the Iranian side in the last few days.”[29] Pakistani sources told Western media on April 24 that a US technical and logistics team is in Islamabad, while a Pakistani official told Axios that the possibility of a trilateral meeting involving Iran, the United States, and Pakistan would be assessed after Araghchi meets with Pakistani officials.[30] Two other unspecified sources told Axios that a meeting between Araghchi, Witkoff, and Kushner could take place on April 27 following separate bilateral discussions between Witkoff, Kushner, and Pakistani mediators.[31]

Likely Iranian-backed Iraqi militias conducted two fiber-optic drone attacks on Kuwaiti border posts on April 24.[32] The Kuwaiti Army reported that unspecified actors launched two fiber-optic drones from Iraq that hit two Kuwaiti border posts, causing material damage but no casualties.[33] Iraqi Interior Minister Abdul Amir Shammari condemned the attacks in a call with Kuwaiti Interior Minister Fahad Yousef Saud al Sabah.[34] Shammari stated that the Iraqi government will form a specialized committee to investigate the attacks and identify and arrest the perpetrators.[35] Iranian-backed Iraqi militias have not claimed these attacks at the time of this writing. Iranian-backed Iraqi militias have demonstrated their ability to use fiber-optic first-person view (FPV) drones during the war, however.[36] FPV drones can be used for intelligence, surveillance, and reconnaissance, or outfitted with strike capabilities to conduct precise targeting.[37] Open-source intelligence (OSINT) analysts have assessed that drone footage posted by Iraqi militias during the war appeared to be from fiber-optic FPV drones, which are immune to jamming.[38] ISW-CTP previously assessed that Russia is the most likely actor to have provided Iran with fiber-optic drone capabilities, which Iran likely shared with Axis of Resistance groups, including Iranian-backed Iraqi militias.[39] Russia and Ukraine have extensively used FPV drones in their war.[40]

These attacks come after three Iraqi militia members and two unspecified officials told Western media on April 21 that Iranian-backed Iraqi militia “hardline factions” are operating under a decentralized command structure with Iranian advisers.[41] ISW-CTP assessed that these ”hardline” factions could refer to Iranian-backed Iraqi militias Kataib Hezbollah and Harakat Hezbollah al Nujaba, both of which are relatively more subordinate to Iran than other militias.[42]

The US naval blockade appears to be constraining Iran's oil storage capacity. Tanker Trackers reported on April 23 that Iran has recommissioned the retired very large crude carrier (VLCC) Nasha into service, likely to expand Iran's floating storage capacity near Kharg Island in the Persian Gulf as Iran's onshore storage capacity decreases.[43] An Iranian parliamentarian warned on April 24 that Iran continues to produce and store oil on Kharg Island but may have to shut in oil wells if Iran's storage capacity runs out.[44] He noted that restarting production would require billions of dollars.[45] These developments indicate that the blockade is not only limiting Iran's oil exports but also creating downstream pressure on Iran's production system by reducing Iran‘s available storage capacity. Iran's Petroleum Products Exporters Union Spokesperson, Hamid Hosseini, told Iranian media on April 16 that the US naval blockade makes a reduction in oil production “inevitable.”[46] Hosseini added that alternative export routes, such as pipelines, can only handle limited volumes and cannot replace the Strait of Hormuz.[47] Shutting in oil wells risks permanent damage to the wells because the wells may not be able to return to previous output levels.[48]

An unspecified US official and a source with knowledge of the issue told Axios on April 24 that the IRGC Navy laid additional naval mines in the Strait of Hormuz this week.[51] If this report is true, the IRGC’s decision to lay additional mines in the strait would be consistent with the IRGC’s effort to try to assert its “control” over the strait. Axios added that this marks the second time that Iran has mined the strait since the war began and noted that it remains unclear whether all of the previously laid mines have been found and cleared.[52] US officials estimated that the United States has destroyed more than 90 percent of Iran's large mine-laying vessels and mine storage sites but assessed that Iran still retains mine stockpiles along its coast.[53]

Hezbollah claimed that it targeted an Israeli community in northern Israel for the first time since the ceasefire went into effect on April 16.[56] Hezbollah claimed that it fired rockets targeting the northern Israeli border community of Shtula on April 23.[57] The attack coincided with a US-brokered meeting between Israeli and Lebanese officials in Washington, DC, on April 23.[58] The Israel Defense Forces (IDF) reported that Hezbollah fired a small barrage of three or four rockets targeting Shtula and that the Israeli Air Force (IAF) intercepted the rockets.[59] Hezbollah also claimed that it has conducted four attacks, including two first-person view (FPV) drone attacks, targeting Israeli forces in southern Lebanon since ISW-CTP’s last data cutoff on April 23.[60] Israeli media characterized IDF and Hezbollah operations during the ceasefire as a “low-intensity conflict” on April 23.[61] Hezbollah parliamentarian Ali Fayyad called the ceasefire “meaningless” on April 24 because it allows the IDF to respond to imminent Hezbollah threats. Fayyad claimed that Israeli military activity gives Hezbollah “the right to a proportionate response.”[62]

https://understandingwar.org/research/middle-east/iran-update-special-report-april-24-2026/

1,958 posted on 04/25/2026 1:17:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1946 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson