Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith

Only buys time.

Doesn’t solve the underlying problem.

When your method for controlling bugs involves any sort of selection at all, you’re playing the game with ‘bug rules’. The bugs will always win when you play the game with their rules.

Never compete, genomically, with a microbe. They have tens, hundreds and possibly thousands of iterations per day to figure out your immune system. You have, at best, one generation every 16 years. They’re throwing genomic spaghetti at the wall with far greater efficiency than humans. They will always win this game when you play by their rules.

Excepting pandemics (smallpox, ebola, etc) the ‘ordinary’ bugs have evolved in a microbial milieu to survive in the presence of our immune system. Likewise we have evolved to survive the predations of them. The predominant strains are those with the least mortality and morbidity. Both from a fitness of the microbe standpoint and a selection against unfit humans. It’s been, at best, an uneasy truce. Modern medicine is now flinging grenades at an enemy they barely understand and essentially hoping for the best. Or at least kicking the can down the road for someone else. One day, sooner or later, a common microbe will turn rabid. We’ll definitely have preferred the ordinary microbe when that happens.

Pertussis is winning the current battle bigtime. We have ‘zero’ vaccines effective against the current escape mutant.

Moreover, the current vaccine selects FOR susceptibility.

Not. Winning. Are. We.


58 posted on 12/28/2015 2:06:36 PM PST by Black Agnes
[ Post Reply | Private Reply | To 55 | View Replies ]


To: Black Agnes

I guess we have to agree to disagree.


59 posted on 12/28/2015 2:08:25 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 58 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson