Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith

Take home conclusion paragraph from the CDC paper:

“Strains carrying nonvaccine-type pertactin or pertussis
toxin variants were not found in the prevaccination era.
Although the number of strains analyzed from this period was
limited, these data suggest that the nonvaccine-type variants
are not able to displace the vaccine-type strains in
unvaccinated populations (i.e., they have a lower fitness level,
or reproductive rate, in unvaccinated communities).
Alternatively, the nonvaccine-type strains may have evolved
relatively recently. Consistent with the first hypothesis, we
have observed that nonvaccine-type strains are less fit in
naive mice than vaccine-type strains. In immune mice the
difference in fitness between the two types of strains was
much less pronounced (unpublished data). Thus vaccination
has acted to shift the competitive balance between strains.”


48 posted on 12/28/2015 12:42:05 PM PST by Black Agnes
[ Post Reply | Private Reply | To 46 | View Replies ]


To: Black Agnes
They are stretching their data to get their results, but I just checked some random papers about http://www.ncbi.nlm.nih.gov/pubmed/?term=pertussis+vaccine and it looks like it is an increase in infections despite vaccination. However, it seems that the reason is that

inactivated pertussis cells (the bacteria that causes whooping cough) drove infection rates in the U.S. below one case per 100,000 people. But adverse side effects of those vaccines led to the development and introduction in the 1990s of acellular pertussis vaccines, which use just a handful of the bacteria’s proteins and bypass most of the side effects. (Currently given to children as part of the Tdap vaccine.)

The problem is, the newer vaccines might not block transmission. A January 2014 study in PNAS by another research team demonstrated that giving baboons acellular pertussis vaccines prevented them from developing symptoms of whooping cough but failed to stop transmission.

Building on that result, Althouse and Scarpino used whopping cough case counts from the CDC, genomic data on the pertussis bacteria, and a detailed epidemiological model of whooping cough transmission to conclude that acellular vaccines may well have contributed to — even exacerbated — the recent pertussis outbreak by allowing infected individuals without symptoms to unknowingly spread pertussis multiple times in their lifetimes.

"There could be millions of people out there with just a minor cough or no cough spreading this potentially fatal disease without knowing it," said Althouse. "The public health community should act now to better assess the true burden of pertussis infection."

What's worse, their model shows that if the disease can be spread through vaccinated, asymptomatic individuals essentially undetected, the level of vaccination needed to protect those that are unvaccinated (so-called ‘herd immunity’) is over 99 percent, impractically high at a time when anti-vaccine campaigns are turning people away from vaccination.

Does this mean the current vaccine is useless? Not at all, the pair says. Until researchers can develop a new pertussis vaccine that blocks transmission, the protection the acellular vaccine offers to individuals is vital.

‘It's the symptoms of pertussis infection that kill people,’ Scarpino says, ‘and the existing vaccine prevents the most debilitating effects of whooping cough.’

In that sense, the research underscores the importance of getting vaccinated, especially for children. "There are lots of people out there who may be transmitting pertussis unknowingly," Scarpino says. "Not vaccinating your own child puts her or him at increased risk of severe disease, even death."

http://www.eurekalert.org/pub_releases/2015-06/sfi-swc062215.php

However, in the case of an ongoing infection there is good news:

A team of researchers from The University of Texas at Austin and Synthetic Biologics Inc. have developed two antibodies to potentially treat or prevent pertussis, the highly contagious respiratory tract infection that affects millions of infants around the world and results in an estimated 200,000 child deaths every year.

http://www.eurekalert.org/pub_releases/2015-12/uota-te120215.php

52 posted on 12/28/2015 1:31:04 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 48 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson