Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith

You may not always be infected with a resistant strain.

Someone else will be.

How do you think we got MRSA?

The current pertussis vaccine escape mutant has a mortality/morbity about 10X greater than the original strain. And the vaccine has zero effectiveness against it.

Try for a 100X strain?

But wait!, there’s more!

http://www.scientificamerican.com/article/baboon-study-reveals-new-shortcoming-of-pertussis-vaccine/


42 posted on 12/28/2015 12:01:56 PM PST by Black Agnes
[ Post Reply | Private Reply | To 39 | View Replies ]


To: Black Agnes

Thanks for your question.

MRSA and many other type of antibiotic restistance are plasmid mediated, the genes encoding these enzymes are easily transferable among different bacteria from different species of bacteria.

You may read this http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4216585/


43 posted on 12/28/2015 12:21:12 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 42 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson