Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

New evolutionary research disproves living missing link theories
University of Montreal ^ | February 10, 2011 | Unknown

Posted on 02/10/2011 4:52:11 PM PST by decimon

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-51 next last
To: Spudx7; SunkenCiv; neverdem; nuconvert; decimon
ALL genetic mutations in species involve a loss of information. Never has there ever been a mutation that included the addition of genetic information-never.

Mathematically, it is the opposite. Assume a group consisting of M members and all having a specific sequence A with N characters, say A= a1a2a3...aN that is the same for all members of the group, then if you change one character for one member of the group then the information content in that changed sequence is increased. Mutations are changes in a genomic sequence, not only point mutations but as well insertions, deletions, duplications, reversions, amplifications, translocations etc.
21 posted on 02/10/2011 11:18:26 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: mamelukesabre
I don’t see it. It’s loss of features due to lack of use. There’s a difference.

What? Blind people have blind children because they don't use their eyes?

22 posted on 02/11/2011 2:31:25 AM PST by Bellflower (Isa 32:5 The vile person shall be no more called liberal, nor the churl said [to be] bountiful.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: mamelukesabre; raygunfan

He wasn’t talking to you. ;-p


23 posted on 02/11/2011 5:23:37 AM PST by TheOldLady ("20 Years Ago Desert Storm began...where were you...?" "I believe I was hitting it." - Lazamataz)
[ Post Reply | Private Reply | To 9 | View Replies]

To: wendy1946

Brilliant as usual. Thanks for the anti-evo ammo.


24 posted on 02/11/2011 5:33:42 AM PST by TheOldLady ("20 Years Ago Desert Storm began...where were you...?" "I believe I was hitting it." - Lazamataz)
[ Post Reply | Private Reply | To 15 | View Replies]

To: decimon

Democrats actually evolved (or devolved, if you prefer) from real human beings. Amazing!


25 posted on 02/11/2011 5:58:47 AM PST by chesley (Eat what you want, and die like a man.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: calex59; TheOldLady
On the off chance you might have missed it, The Basic Non Evolution of Modern Man.
26 posted on 02/11/2011 7:35:45 AM PST by wendy1946
[ Post Reply | Private Reply | To 20 | View Replies]

To: wendy1946

Well done!

For macro evolution to have occurred on the scale claimed by the darwinists requires more faith than reason.

The scientific community can not create on purpose what they claim occurred by accident...and yet they claim that it occurred over and over and over. New species are not created from existing ones.


27 posted on 02/11/2011 9:29:46 AM PST by killermosquito (Buffalo, Detroit (and eventually France) is what you get when liberalism runs its course.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

Thank you. Do you have a ping list? If so, please add me. You have a way of explaining things that makes complicated intellectual and scientific arguments understandable.


28 posted on 02/11/2011 9:39:44 AM PST by TheOldLady ("20 Years Ago Desert Storm began...where were you...?" "I believe I was hitting it." - Lazamataz)
[ Post Reply | Private Reply | To 26 | View Replies]

To: decimon

“Darwin’s theory of evolution continued this idea, with the concept of a hierarchy of evolution. This way of thinking has led researchers and skeptics alike to look for less sophisticated ancestors in order to prove or disprove evolution,” Philippe explained. “What we now know is that evolution does not happen in a single direction – when people talk about a missing link, they’re generally excluding the possibility of more sophisticated ancestors.” “

—One of the things that separates Darwinism from Lamarckism and Haeckel is that it doesn’t continue with the concept of a hierarchy.

Darwin was also well aware that evolution was not directional, and that living things often became simpler instead of more complex. Many, many such cases are known. Not only is this not “new”, it’s not even uncommon. It’s particulary common among parasites.

Darwin himself studied such a case for 8 years before publishing Origin, which would become the textbook example - the barnacle. Such things are precisely what Darwin was attempting to explain, so it’s very odd to present this as “new”.

http://scienceblogs.com/evolvingthoughts/2007/02/basic_concepts_progress_primit_1.php


29 posted on 02/11/2011 9:44:38 AM PST by goodusername
[ Post Reply | Private Reply | To 1 | View Replies]

To: killermosquito; TheOldLady
For macro evolution to have occurred on the scale claimed by the darwinists requires more faith than reason.

One way of looking at it, the total sum of miracles in the Bible is probably somewhere between 30 and 100, and probably more like 30 or 40. By contrast, evolution requires an essentially infinite sequence of probabilistic miracles for every kind of creature which ever existed on the Earth i.e. a double infinity of miracles and zero-probability events.

Which is the religion? What I sometimes tell people is that you could make up a new religion by taking the single stupidest idea or doctrine from each of the existing religions and even THAT would be better than evolution.

Evolutionites within my experience are basically immune to logic but they are not immune to laughter and ridicule. What I ultimately hope to do is to teach people how to laugh at this stuff. Laughter is the one thing which no ideology can tolerate and the one thing which can ultimately get false religions like I-slam and the theory of evolution out of this world.

30 posted on 02/11/2011 9:58:49 AM PST by wendy1946
[ Post Reply | Private Reply | To 27 | View Replies]

To: wendy1946

For Plato and Aristotle laughter is an emotion involving scorn for people thought of as inferior. Plato also objects that laughter involves a loss of self-control that can lead to violence. And so in the ideal state described in his Republic and Laws, Plato puts tight restrictions on the performance of comedy.

This negative assessment of laughter, humor, and comedy influenced early Christian thinkers, who derived from the Bible a similar understanding of laughter as hostile. The classic statement of the Superiority Theory is that of Thomas Hobbes, who describes laughter as an expression of »sudden glory«.

http://webcache.googleusercontent.com/search?q=cache:ZPVj-aV4LRoJ:www.jltonline.de/index.php/articles/article/viewArticle/238/713+laughter+plato+bible&cd=11&hl=en&ct=clnk&source=www.google.com

So, we have to be careful. ;-)

Have a nice weekend


31 posted on 02/11/2011 10:55:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 30 | View Replies]

To: wendy1946

That is without doubt one of the best posts I’ve ever read in over 10 years on FR.


32 posted on 02/11/2011 3:22:28 PM PST by agrace
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

Bump for later reference


33 posted on 02/11/2011 3:39:34 PM PST by Senator_Blutarski
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

One of the best posts I have seen on this subject. Great. Thanks!


34 posted on 02/11/2011 9:52:21 PM PST by daisy mae for the usa (because)
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946

Very well put!


35 posted on 02/13/2011 9:50:32 PM PST by Trillian
[ Post Reply | Private Reply | To 15 | View Replies]

To: wendy1946
Well written wendy1946. Do you mind if we borrow your succinct and compelling verbiage and spread it around?

I first realized the points you point out as I was studying the theory of evolution in college as a believer in it and as an atheist. It became very hard for me to understand why others believed it any more. My Professors had no answers for my many questions but rather spoke in circles. Suffice to say it wasn't before too long that, by the grace of God, I became a saved born again believer. Hope you are too.

36 posted on 02/14/2011 1:39:32 AM PST by Bellflower (Isa 32:5 The vile person shall be no more called liberal, nor the churl said [to be] bountiful.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Bellflower
Well written wendy1946. Do you mind if we borrow your succinct and compelling verbiage and spread it around?

Feel free, that's what it's there for, but there is one big caveat: the biggest problem most people have with religion is the so-called 'problem of evil', and not evolution, and a reasonable answer to that one has to arise from logic and first principles and not from bible studies. The basic DNA/RNA code which forms the basis for all life is clearly the work of a single pair of hands. Nonetheless by the time you get to some point around 5000 - 20,000 years back on our own planet, the engineering and re-engineering of complex life forms appears to have become some sort of a cottage industry, with numerous hands involved. There is no rational way to picture an omnipotent and well-intentioned God creating ticks, chiggers, mosquitos, biting flies, disease vectors, or the myriad creatures of Pandora's box; whoever created those things is not anybody we need to worship. Likewise there is no rational way to picture an omniscient God needing to go through 100 species of horses or elephants to get to the one he wanted.

The problem of evil generally compels me to believe that God may in fact be omnipotent within his own realm, but has vanishingly little power to act in this physical realm which we inhabit. The problem seems to hang on the word 'omnipotent', and what it is supposed to mean. Defining it to mean "Having all the power which anybody can imagine" leads to conundrums; defining it to mean "Having all the power which there actually is" does not lead to conundrums.

37 posted on 02/14/2011 6:19:56 AM PST by wendy1946
[ Post Reply | Private Reply | To 36 | View Replies]

To: Bellflower
On the off chance you'd not already seen it, the thing about the supposed evolution of modern man which I posted on FR recently .
38 posted on 02/14/2011 6:25:40 AM PST by wendy1946
[ Post Reply | Private Reply | To 36 | View Replies]

To: Spudx7
Nylonase.

Before nylon was invented there was nothing for a nylonase gene to do.

After nylon was invented, they discovered a bacteria living near the water outflow of the nylon plant that had mutated an esterase enzyme so that the “new information” could now digest nylon.

A single bacteria plated and grown up into a population only has an “information set” of one. As that population is plated onto ten different plates and subjected to ten different environmental pressures, the “information set” expands through mutation, and selective pressure eliminates all but those variations that survive better to whatever pressure the population is subjected to.

Our resulting ten populations resistant to the experienced pressure now have at least ten different “information sets”, each one allowing it to survive and thrive in an environment that would kill the ancestral population.

39 posted on 02/14/2011 6:30:35 AM PST by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: decimon

Semantics.

You can call it “Darwin’s theory of adaptation through natural selection of genetic variation” if you want, it changes nothing, the mechanism of change is exactly the same.


40 posted on 02/14/2011 6:31:53 AM PST by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 8 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-51 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson