Free Republic
Browse · Search
General/Chat
Topics · Post Article

Interesting concept.
1 posted on 07/18/2010 9:15:06 AM PDT by annie laurie
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv; neverdem

Ping of possible interest.


2 posted on 07/18/2010 9:16:47 AM PDT by annie laurie (All that is gold does not glitter, not all those who wander are lost)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: annie laurie

btt


3 posted on 07/18/2010 9:26:33 AM PDT by mnehring
[ Post Reply | Private Reply | To 1 | View Replies ]

To: annie laurie; Godzilla

I remember a group of Japanese girls singing the chorus to the genetic code of a prehistoric plant.

They ended up pi$$ing off baby Godzilla and awakening Rodan.


4 posted on 07/18/2010 9:32:53 AM PDT by RandallFlagg (30-year smoker, E-Cigs helped me quit, and O wants me back smoking again?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: annie laurie

There is a popular workshop that translates your individual horoscope into the warp and weft of a weaving pattern. These patterns are physically set down in a manner resembling notes on a piece of sheet music. The lines represent the woof and the “notes,” the weft and the order in which you pull the harnesses. I suppose you could sing that as well - or, you might weave the allele pattern. It is all mathematics.


5 posted on 07/18/2010 9:34:36 AM PDT by marsh2
[ Post Reply | Private Reply | To 1 | View Replies ]

To: annie laurie; SunkenCiv
ATTAGATAAAGAGAGATTATTAAAATTGGG


7 posted on 07/18/2010 5:56:04 PM PDT by martin_fierro (< |:)~)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson