Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith
This statement is fascinating:
Within the synthesized genome, Venter and colleagues left a watermark to clearly identify their work — four added DNA sequences whose string of bases spell out messages. The first watermark includes a code with which to decipher the others, including the names of the contributing scientists, three famous quotes, and an email address. “If people can decipher the code, they can send an email to us,” said Venter. http://www.the-scientist.com/blog/display/57443/
Imagine being able to send an eMail to God (or Satan) as a result of one's research into evolotionary biology.

Sounds farfetched, I'm sure. What is this 'watermark' thing? And if either of the aforementioned supernatural beings actually exist, how'd such be recognized in their work?

85 posted on 05/23/2010 5:09:22 AM PDT by raygun
[ Post Reply | Private Reply | To 80 | View Replies ]


To: raygun

The watermark is simply a string of non-coding DNA that they inserted in the sequence. Nothing else.


87 posted on 05/23/2010 5:31:33 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 85 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson