Cro-Magnon 28,000 Years Old Had DNA Like Modern Humans

Science Daily ^ | July 16, 2008

[allmendream]

More like less than 80% DNA homology between humans and rats, not 97%. What is your motivation for making up numbers without knowledge of the subject. What are you trying to indicate by such an obfuscation?

Mary Schueler, Ph.D.

This expert's focus:
Comparing the DNA sequence of essential chromosomal regions from multiple primates to define functional changes that have occurred during evolution.
: Generally, human DNA is most similar to more closely related species like the great apes - chimp, gorilla, and orangutan. These are more closely related to us in evolutionary time. Species that have been separated from us for longer periods of time share less similarity. As you compare with species farther away from us on the evolutionary tree, we observe that DNA sequences that code for proteins are conserved while other sequence is not. This is thought to be due to the necessary function of the proteins in the life of the cell. If the sequence changes, the cell can't survive. We are less than 90% similar to most other species. Even within the primate lineage, as compared to old world monkeys, protein coding sequences can vary by as much as 15% (be 85% similar). As you move further away to mice and flies and yeast, the percentage similarity falls off quite a bit.

[Oztrich Boy]

Cro-Magnon 28,000 Years Old Had DNA Like Modern Humans

If that's true, why can't modern humans live to be more than 80-120 years old?

[allmendream]

Actually in DNA that codes for a protein (a gene) the similarity between humans and chimps is around 98%. Over the entire genome the difference is around 93-95% the same. This pattern holds true when comparing more distantly related species. A comparison with a New World monkey and humans would yield a 85% or less genetic DNA homology and the non-genetic DNA would vary by an even larger degree.

[Neoliberalnot]

The blueprint containing information for all different life-forms is based on the most efficient means of storing complex data ever devised—DNA/RNA packaged within nuclear proteins. Just because the same mechanism is used to store the information is no basis for suggesting each life form evolved from another.

[allmendream]

No but the nested hierarchy of similarity and divergence of genetic DNA, the increased divergence of non genetic DNA, and even the nested hierarchy of similarity in ERV insertion sequences are all an excellent basis for suggesting that we share a common descent.

What else explains the fact that if a human and gorilla but not oragutang share an ERV it will most certainly be in a chimp, and be less diverged from the original viral sequence than one shared between all primates and less diverged from the original viral sequence than an ERV only in humans?

[Fractal Trader]

GGG ping

[autumnraine]

I don’t think one evolved into another. In fact, I think the more secrets we unlock with DNA, the more questions we will have. I think some interesting information will come out about the theory of one species evolving into a completely different species.

[autumnraine]

“More like less than 80% DNA homology between humans and rats, not 97%. What is your motivation for making up numbers without knowledge of the subject. What are you trying to indicate by such an obfuscation?”

Sorry I was incorrect, but I wasn’t just making up numbers. I was attempting to recall the number that I read at the Fernbank Science Exhibit on DNA. If their information is incorrect, I apologize. Or if my memory failed me. However I am not trying to “indicate” anything. And your snobbish assumption of me making up the information I posted is disturbing.

[allmendream]

Usually when people make wild exaggerations it is to indicate a point.

And obviously you were pulling a number out of nowhere that had no substantiation as it is absolutely incorrect.

Usually the tact of “we are some exaggerated % the same as a newt” is used by those who wish to discount the obvious significance of our 98% genetic homology with chimps. If this was not your intention I apologize for assuming there was any forethought or intent in the incorrect and wildly exaggerated number you cited.

[Let's Roll]

Geico dudes ARE Neanderthals.

Cro-Magnons look like modern Europeans.

[autumnraine]

I understand, and people do tend to throw around numbers alot. But I seriously was typing and thinking “Wasn’t it like 97% with rats in that exhibit?” I do remember thinking “WOW, we are that similiar in DNA?” It was a very good exhibit, I just have a very bad memory. I guess I should have checked before posting, but sometimes I forget we aren’t in chit chat here.

[valkyry1]

Also since the extraction of DNA is a complicated bio-chemical process, it cannot be determined to what degree the extracted DNA is different from pristine DNA.

[allmendream]

Not even a gorilla is 97% the same in the genetic DNA, and a gorilla is closer in DNA homology to humans and chimps than any other species. The 3% difference you misremembered isn't even in the same ballpark. And yes, this is Free Republic, and if you wish people to take what you say seriously it helps if you don't pull out numbers completely at variance with reality.

[valkyry1]

Its not quite like they say. I hope you find this link informative.

“Will evolution be called into question now that the similarity of chimpanzee and human DNA has been reduced from >98.5% to ~95%? Probably not. Regardless of whether the similarity was reduced even below 90%, evolutionists would still believe that humans and apes shared a common ancestor. Moreover, using percentages hides an important fact. If 5% of the DNA is different, this amounts to 150,000,000 DNA base pairs that are different between them!”

http://www.answersingenesis.org/tj/v17/i1/DNA.asp

[allmendream]

Perhaps you don't know anything about how DNA is extracted and read and compared between samples to reach a consensus sequence.

Perhaps you think if you throw some mud around it will make people think something that is rather simple and known is somehow all up in the air.

If I extract the DNA from a cell and sequence it why is it I get the same answer within 98% every time? And why when I compare the same reading of the same sequence it is easy for me to see which bases in which samples differ from the consensus sequence.

A real DNA readout is shows much more fidelity, but for the purpose of illustration say I had the following...

ATCGCATACATGCATCAGCTACAT
ATCGCACACATGCATCAGCTACAT
ATCGCATACATGCATCACCTACAT
ATCGCATACATGCATCATCTACAT
ATCGCATACATGCAACAGCTACAA
ATCGCATACATGCATCAGCAACAT

It is quite easy to see what the real sequence is if one uses an iota of intelligence.

[autumnraine]

Hey, I’ll be darned, I just found an article that supports the information I apparently remembered correctly.

http://www.newscientist.com/article/dn2352-just-25-of-dna-turns-mice-into-men.html

Humans share 97.5% of their dna with mice.

I think someone owes me an apology as well.

[allmendream]

The similarity between human and chimpanzee DNA is BOTH 98.5% and 95%. When comparing the DNA sequence of genes the number is 98.5%. It is even higher when comparing the Amino acid sequence that the genes code for, as the DNA code is redundant and more than a third of the differences in that 1.5% difference between us and chimps is at the third codon where it is less likely to change the Amino acid specified. When comparing the entire genome, including sequences that do not code for proteins and have not been shown to be under selective pressure; there is of course MORE difference, around 5%.

But answers in genesis either wouldn't understand the difference, or wouldn't accurately portray the difference. They would rather try to convince people that the similarity has been reduced, rather than admitting that both numbers are accurate depending upon what exactly is being compared.

[allmendream]

Here is the abstract the article cited; they say nothing about a 2.5% genetic difference...

Science 31 May 2002:
Vol. 296. no. 5573, pp. 1661 - 1671
DOI: 10.1126/science.1069193

A Comparison of Whole-Genome Shotgun-Derived Mouse Chromosome 16 and the Human Genome

The high degree of similarity between the mouse and human genomes is demonstrated through analysis of the sequence of mouse chromosome 16 (Mmu 16), which was obtained as part of a whole-genome shotgun assembly of the mouse genome. The mouse genome is about 10% smaller than the human genome, owing to a lower repetitive DNA content. Comparison of the structure and protein-coding potential of Mmu 16 with that of the homologous segments of the human genome identifies regions of conserved synteny with human chromosomes (Hsa) 3, 8, 12, 16, 21, and 22. Gene content and order are highly conserved between Mmu 16 and the syntenic blocks of the human genome. Of the 731 predicted genes on Mmu 16, 509 align with orthologs on the corresponding portions of the human genome, 44 are likely paralogous to these genes, and 164 genes have homologs elsewhere in the human genome; there are 14 genes for which we could find no human counterpart.

http://www.sfgate.com/cgi-bin/article.cgi?f=/c/a/2002/12/05/MN153329.DTL&type=science

This article sources the identical paper and says...

“On a letter-by-letter basis, the genes are 85 percent the same.”

Very interesting! I am attempting to get the original article to see why there is this discrepancy.

I apologize if your error was made in good faith, if it was indeed an error at all.

[allmendream]

Also when one compares the entire genome of a mouse and human, rather than just the genetic sequences that tend to be conserved between lineages due to functional constraints and selective pressure; rather than a 95% similarity with humans that we see with chimps, mice are around 40% similar at the genomic level; by way of comparison.

http://www.genome.gov/page.cfm?pageID=10005831

[autumnraine]

Thank you. This is interesting as I am a novice in DNA, I do find it fascinating. Hence my remembrance of that tidbit of information I read while studying the subject at the science center.

I will look into the what you have posted. I do not know enough to merit a debate in the accuracy, but I do feel better knowing I didn’t completely lose my memory. I have a photographic memory (although not 100%) and when I was recalling it, I remembered the placard and the surrounding area when reading it. So I was pretty sure, but not positive. But that doesn’t mean they were correct themselves.

Thanks again!