Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,921-9,9409,941-9,9609,961-9,980 ... 22,161-22,164 next last
To: PIF; BroJoeK; blitz128

It is highly unlikely to be built, even though they say they plan to allocate 90 billion rubbles in the 2025 budget. https://portnews.ru/news/368492/

It’s not just a lack of money that will stop the project.


9,941 posted on 12/25/2024 1:14:17 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9934 | View Replies]

To: AdmSmith

Merry Christmas!


9,942 posted on 12/25/2024 2:08:02 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9941 | View Replies]

To: BeauBo

Merry Christmas!


9,943 posted on 12/25/2024 2:08:15 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9940 | View Replies]

To: blitz128

Merry Christmas!


9,944 posted on 12/25/2024 2:08:29 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9937 | View Replies]

To: BroJoeK

Merry Christmas!


9,945 posted on 12/25/2024 2:08:43 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9933 | View Replies]

To: gleeaikin

Merry Christmas!


9,946 posted on 12/25/2024 2:09:01 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9924 | View Replies]

To: marcusmaximus

Merry Christmas!


9,947 posted on 12/25/2024 2:09:13 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9921 | View Replies]

To: ansel12

Merry Christmas!


9,948 posted on 12/25/2024 2:09:22 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9919 | View Replies]

To: FtrPilot

Merry Christmas!


9,949 posted on 12/25/2024 2:10:34 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9914 | View Replies]

To: PIF

Merry Christmas to all


9,950 posted on 12/25/2024 2:11:26 PM PST by blitz128
[ Post Reply | Private Reply | To 9944 | View Replies]

To: AdmSmith

“It (Next Gen icebreaker) is highly unlikely to be built, even though they say they plan to allocate 90 billion rubbles in the 2025 budget.”

Taking away Russia’s money, is one cure, for a thousand illnesses.

Not just icebreaker competition in the Arctic, not just Military re-armament, but also political subversion all over the world, including the USA.

The Russian Government cannot be trusted with wealth, and must be denied it, for the good of the world.


9,951 posted on 12/25/2024 2:11:48 PM PST by BeauBo
[ Post Reply | Private Reply | To 9941 | View Replies]

To: PIF

9,952 posted on 12/25/2024 2:14:41 PM PST by BeauBo
[ Post Reply | Private Reply | To 9943 | View Replies]

To: FtrPilot

Everybody! Party on Russia’s former market share!

Just about anyone would spend that revenue better than Putin would, so let’s take it away. Let’s recognize the Strategic importance of the Business Battlespace, and seize the high ground of long term oil and gas revenues.

OilPrice.com (Simon Watkins) reports:

Big Oil Looks to The Eastern Mediterranean as Replacement for Russian Gas

“...It is also a key part of the new Trump Presidential Administration’s push to destroy the financing at the heart of the ‘Axis of Resistance’ in the Middle East spearheaded by Iran and, in turn, to scupper the broader China-led strategy to replace the dominant influence of the U.S. and its key allies in the world with an alternative version in which China plays the dominant role...

...as it became apparent that LNG would be the key emergency energy supply in the new global oil market order, more supplies of it from other sources over which the U.S. and its NATO allies could gradually exert a significant broader economic and political influence came into play as well. A key focus of this was the Eastern Mediterranean region, especially Egypt and Israel. The major players at the forefront of this concerted strategy were oil and gas majors from the U.S. (including ExxonMobil, Chevron, and ConocoPhillips), from the U.K. (especially Shell, and BP), France (most notably TotalEnergies), and Italy (with Eni taking the lead).

The pace of gas supply development in Egypt had been seamlessly spectacular up until recently... it also has potentially huge gas reserves. These are very conservatively estimated at around 1.8 trillion cubic metres (Tcm)... It is also the only country in the Eastern Mediterranean gas hotspot region with operational LNG export capacity... The Suez Canal importance to the global energy sector is further boosted by the fact that it is one of the very few major transit points that is not controlled by China (although Egypt recently joined BRICS)...

...the attention of the same Western firms active in Egypt is refocusing on the parallel Eastern Mediterranean gas hotspot of Cyprus, which is now considering a new licensing round for offshore natural gas exploration... It estimates current untapped gas reserves of around 0.45 Tcm... The island has 13 offshore blocks, with 10 of these already under licence to the same Western energy majors active in Egypt — including ExxonMobil, Chevron, TotalEnergies, and Eni... At the end of last month, ExxonMobil’s vice-president for global exploration, John Ardill, said that “There is huge potential for gas exploration” around the island and that the firm will be spudding its first well in mid-January. Having won its initial licences in Cyprus in 2017, ExxonMobil made its first big find in 2019 at the Glaucus well and has since found two new potential major discoveries in Pegasus and Electra. Electra (in Block 5) has the benefit as well of being close to its Glaucus operation (Block 10) and to the huge Cronos discovery (Block 6) being developed by Eni and TotalEnergies.”


9,953 posted on 12/25/2024 2:50:24 PM PST by BeauBo
[ Post Reply | Private Reply | To 9914 | View Replies]

To: BeauBo

Not so merry a Christmas for Putin.


9,954 posted on 12/25/2024 3:24:06 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9953 | View Replies]

To: PIF

lol as the usuals will point out for Putin Christmas is Jan 7, so therefore it is Christmas for everyone 😎🤮


9,955 posted on 12/25/2024 5:36:39 PM PST by blitz128
[ Post Reply | Private Reply | To 9954 | View Replies]

To: AdmSmith; FtrPilot; blitz128; PIF; BeauBo

The fact that somewhere along the line I saw something about these hatch covers being nuclear resistant or some such, now makes me wonder if these icebreakers are going to function as surface nuclear “subs”. A submarine is far more at risk trying to travel in arctic waters, even if there is an icebreaker to make a path. I don’t know to what extent we can position our own atomic subs in arctic waters to keep an eye on Russian activity there. I can imagine the possibility of a nuclear missile armed icebreaker coming a lot closer to US territory, especially Alaska, and also to Canadian territory than might a Russian nuclear sub. The minutes warning of a strike in the US or Canada would be seriously reduced in such a case.

Regarding a new port base in Libya for Russia, I wonder if Ghadaffi would have agreed to this? Sometimes people need to be careful about what they wish for. At any rate, I hope their new nearby neighbor will encourage Spain, Italy, and Portugal to bring their NATO contribution up to the minimum 2% GNP they currently don’t meet. Of course, the 3% level would be even better which several of the smaller NATO members have already reached, and Poland at over 4% is doing very well.


9,956 posted on 12/25/2024 9:28:00 PM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 9926 | View Replies]

To: AdmSmith; PIF; FtrPilot

I just reread comments #9909 and #9912 and saw again the idea that the hatch covers were for a submarine (but perhaps that is a fake so they could be used on an icebreaker). Then I saw the suggestion that the ship was supposed to pick up a secret cargo in Syria, and there were only empty containers in the hold of the ship. So, now I wonder if Russia had some nuclear weapons in Syria and was planning to ship them to Vladivostok and either put them in a submarine, or an icebreaker.


9,957 posted on 12/25/2024 9:43:29 PM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 9926 | View Replies]

To: blitz128; BeauBo; AdmSmith

Actually Dec. 25th may have been chosen as a specific insult to Zelensky since Z has chosen important days like Putin’s birthday for some special attacks. The fact that Zelensky has Jewish ancestry, and a major Jewish holiday falls on Dec. 25 this year perhaps Putin is sending a special and personal message.


9,958 posted on 12/25/2024 9:49:40 PM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 9929 | View Replies]

To: PIF

In the 2010’s, Russia exported arms to over 60 countries. This year, only 11.

It is not just a wartime pause, those customers are now overwhelmingly buying Western weapons instead. India is now buying Western aircraft. Turkey has cancelled S-400 orders. Serbia is now negotiating going Western. Most of the former Warsaw Pact have been dumping their old Russian weapon systems into Ukraine, and are largely not replacing the Russian platforms, rapidly converting their fleets proportionally to NATO standard platforms

It is not only the direct revenue that Russia is losing. They have lost the foreign volumes that paid a lot of the overhead for their continued R&D.

Even more, these many countries re-platforming from Russian gear to Western, are becoming unbound from dependence on Russia, and becoming bound to increasing dependence on Western arms industries for sustainment and operations - ammunition, repair parts and technical support.

When push comes to shove, and countries have to assess who they can or cannot afford to oppose, many that previously would have had to align with Russia (actively or passively), are rapidly shifting toward Western military dependence instead. Even if their motivation was simply to get the best weapons for their own purposes, the effect will be a natural realignment of their calculus. And it has been a stampede.


9,959 posted on 12/25/2024 9:54:58 PM PST by BeauBo
[ Post Reply | Private Reply | To 9954 | View Replies]

1,540 i.e. more than 1.06 Russians and Norks/min


9,960 posted on 12/25/2024 11:35:24 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9927 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,921-9,9409,941-9,9609,961-9,980 ... 22,161-22,164 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson