Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,841-9,8609,861-9,8809,881-9,900 ... 18,701-18,703 next last
To: AdmSmith

Putin is just full of excuses for his failure.


9,861 posted on 12/23/2024 6:59:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9858 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Valley of Death: North Koreans Erased in Seconds by HIMARS ]


Today [ Dec 22, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, the fight for Kruglenkoe reached a brutal new phase, as Russians finally decided to give their North Korean allies fire support. However, their concentrated advancing forces quickly came under devastating HIMARS cluster munitions fire, as Ukrainians lured the North Koreans directly into a trap.

After a series of failed meat-wave attacks by North Korean forces, capturing Kruglenkoe remains the top priority for the Russian counteroffensive. Securing Kruglenkoe would enable the North Koreans to establish fire control over the primary logistics route supplying Ukrainian forces in Novoivanovka, thereby threatening their rear positions.

This would place the Ukrainian defenders at risk of encirclement, potentially forcing their withdrawal, and paving the way for a Russian breakthrough in Novoivanovka. Controlling both Novoivanovka and Kruglenkoe would further allow Russian and North Korean forces to mount a direct assault on Malaya Loknya, slicing off a significant portion of the Kursk salient in the process.

Despite suffering heavy losses, the North Koreans managed to secure a foothold in the forest north of Kruglenkoe through sheer numbers. Control of this larger forest gives the North Koreans a significant tactical advantage.

The size of the forest allows North Koreans ample space to gather and hide their forces in preparation for an assault further toward the south. In contrast, Ukrainian forces are limited to smaller forest patches near Kruglenkoe, putting Ukrainians at a severe tactical disadvantage.

However, due to the low skill level of the North Korean soldiers, they were unable to properly conceal themselves or establish defensive positions. This left them highly vulnerable to Ukrainian artillery strikes, drone attacks, and targeted raids, resulting in severe losses, and effectively halting their advance.

This caused Russian generals to realize that they must assist their North Korean allies to avoid the complete destruction of their forces, but most importantly, to prevent the loss of their tactical foothold in the forest.

Ukrainian forces in the area reported a significant increase in Russian artillery operations, with Russian aviation deploying as many as 40 glide bombs daily on Ukrainian positions around Kruglenkoe.

The Ukrainian positions in the narrow tree lines, with limited space to conceal their troops or establish effective defenses, left them highly exposed to the Russian bombardment. However, the Ukrainians recognized a tactical opportunity in this vulnerability. They understood that by vacating these positions, the advancing North Korean forces would inevitably face the same challenges.

As the Ukrainians withdrew, the North Koreans moved into the narrow valley, where the constrained terrain worked against their strategy of using overwhelming numbers, as they were forced to bunch together.

Ukrainian fighters carefully monitored the movement of North Korean forces, whereafter they relayed the coordinates to HIMARS operators as they loaded their rocket systems with cluster munitions.

What followed was a catastrophic outcome for the North Koreans, as the Ukrainian strikes devastated their tightly packed assault units, leaving them with no room to maneuver or retreat. Footage of the aftermath of the Ukrainian strikes shows that the valley had become a kill zone, and that the North Korean attack was decisively crushed.

Overall, the Ukrainians took advantage of the concentrated North Korean meat-wave attacks, and forced them into a narrow area of the valley with little space to maneuver, effectively destroying their entire assault group with deadly efficiency. Therefore, the tactical withdrawal not only minimized Ukrainian losses, but also turned the tables on the North Koreans, inflicting heavy casualties and stalling their advance.

Interestingly, the South Korean intelligence agency recently reported that North Koreans have suffered over a 1,000 casualties already, only during the first week of offensive operations in Kursk. The consistent disasters that the repeated North Korean attacks had turned into, will likely soon force them to halt all offensive operations, in order to recuperate and reorganize, further delaying their advance.


9,862 posted on 12/23/2024 7:08:45 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9856 | View Replies]

To: BeauBo
Stupidity has no bounds in Russia: Thousands of bags of fuel oil collected on the resort beach in Anapa are getting washed away back into the sea.

Thousands of tons of fuel products were spilled by 3 decrepit tankers in Russia's shadow fleet in the Black Sea.

https://x.com/igorsushko/status/1870940179994915246


9,863 posted on 12/23/2024 7:19:49 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9855 | View Replies]

To: PIF; AdmSmith
Excellent information, thanks for posting.

It is clear that the norks and ruzzians are not using COMSEC procedures.

Their radios must not have secure voice.

All of your recent reports have been specific at to whether the troops are norks or ruzzian.

My guess is that all ruzzian/nork radio intercepts are being analyzed in real-time with enemy troop locations and numbers being sent to the front in time to react or counter-attack.

UKF effectiveness is reflected in the daily numbers being posted by AdmSmith.

9,864 posted on 12/23/2024 7:36:19 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9862 | View Replies]

To: BeauBo; All
🔥❌ Novoshakhtinsk oil refinery in the Rostov region has stopped both primary oil refining units and completely stopped, according to local media.

😎 It was "assisted" in this by a joint operation of SBU and Ukrainian Navy, which took place last Thursday.

https://x.com/Maks_NAFO_FELLA/status/1871128742040400046

It is difficult to keep track of all the refinery & petroleum storage fires we have seen recently.

Biden put restrictions on Ukraine's ability to attack ruzzian petroleum infrastructure for fear of world price increases.

So, Biden has eased those restrictions or UKF are simply ignoring them.

My guess is that President Zelenskyy discussed this with President Trump and was given a green light by President Trump.

9,865 posted on 12/23/2024 7:52:15 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9856 | View Replies]

To: AdmSmith; BeauBo
⚡️ Moscow plans a new offensive in Zaporizhzhia and Kherson, targeting the right-bank region, per RBC-Ukraine.

🇷🇺 Russia may focus on Pyatikhatki and Hulyaipole in Zaporizhzhia while intensifying efforts near Antonivskyi Bridge in Kherson.

The operation, led by Airborne Commander Mikhail Teplinsky, reportedly involves 4,000 troops, including elite airborne and marine units.

https://x.com/NOELreports/status/1871101992174592330

The operation, led by Airborne Commander Mikhail Teplinsky, reportedly involves 4,000 troops, including elite airborne and marine units.

Very specific intel.

I wonder why Ukraine would publish this information.

9,866 posted on 12/23/2024 7:59:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9865 | View Replies]

To: PIF
💥 Russia: Nighttime strikes by Ukrainian CODE 9.2 drone specialists neutralized 69 North Korean soldiers using Baba Yaga drones.

Each drone, usually armed with four 3BK19 HEAT shells, delivered an average of 4 kills per run.

The North Korean battalion aborted the offensive.

https://x.com/igorsushko/status/1870908040448504319

Baba Yaga drones are amazing.

They are being modified to shoot rifles and grenades.


9,867 posted on 12/23/2024 8:06:49 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9866 | View Replies]

To: FtrPilot

The operation, led by Airborne Commander Mikhail Teplinsky, reportedly involves 4,000 troops, including elite airborne and marine units.


Because Teplinsky has been in charge of that sector for several years. And has long claimed that he can take back Kherson.


9,868 posted on 12/23/2024 8:07:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9866 | View Replies]

To: BeauBo
🇺🇦💥 Russia shuts down one of its largest oil refineries after a joint drone and missile strike by Ukraine's SBU and Navy.

The Novoshakhtinsk refinery in Rostov region, which processed 15K tons of oil daily into fuel for Russian military equipment, is now completely offline after last week's attacks.

https://x.com/NOELreports/status/1871193570939408744

...missile strike by Ukraine's SBU and Navy...

UKF have developed the ability to launch drones from ships.

This would allow the drones to fly a route that avoids ruzzian radars, SAMs & AAA.


9,869 posted on 12/23/2024 8:29:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9867 | View Replies]

To: FtrPilot

So they were too stupid, lazy, or exhausted to pull the bags above high tide. Or they did not have enough trucks, fuel, and labor to load and transport this salvage to a treatment plant. Or probably both. I pitty the poor kids along the Black Sea coast who will have to suffer having tar removed from their little feet with kerosene as I did from 1944 to around 1948 in New Jersey. There must have been a lot of Sunken ships for the tar problem to last for that many years.


9,870 posted on 12/23/2024 8:57:48 AM PST by gleeaikin (in Question authority as you provide links)
[ Post Reply | Private Reply | To 9863 | View Replies]

To: gleeaikin

All the above.


9,871 posted on 12/23/2024 10:08:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9870 | View Replies]

To: FtrPilot

Could there still be any “elite” units left?


9,872 posted on 12/23/2024 10:10:04 AM PST by blitz128
[ Post Reply | Private Reply | To 9866 | View Replies]

To: AdmSmith

“North Korea appears to be preparing to deploy additional troops and military equipment to Russia”

Kyiv Post reports today:

1,100 North Korean Casualties in Russia-Ukraine War: Seoul

“More than 1,000 North Korean soldiers have been killed or wounded in Russia’s war with Ukraine, South Korea’s Joint Chiefs of Staff (JCS) said on Monday.

The new figure follows a report by Seoul’s spy agency to MPs last week, which said at least 100 North Korean soldiers had been killed since entering combat in December.”


9,873 posted on 12/23/2024 10:11:26 AM PST by BeauBo
[ Post Reply | Private Reply | To 9859 | View Replies]

To: FtrPilot

Russia’s loss of transshipment of natural gas through Ukraine (Druzhba Pipeline) this coming New Year’s Day, will deprive Russia of more than just revenue. It will also loosen its political grip over the satellite areas it has been influencing/controlling with it energy weapon.

Kyiv Independent reports:

“Moldova enacted a state of emergency, as the country gears up for an energy crisis at the start of 2025 following the end of Ukraine’s obligations to transport Russian gas through its territory.

Moldova, and especially the country’s breakaway region of Transnistria, will be hit the hardest following the end of the decades-long agreement.

Moldovan Prime Minister Dorin Recean said that the country has enough gas, bought on the international market, to keep the right bank of the Dniester (Nistru) River warm throughout the winter ahead.

But, he added, some 360,000 citizens on the left bank of the river, in the Russia-controlled region of Transnistria, “are still dependent on one source of import — Gazprom.””

Happy New Year.


9,874 posted on 12/23/2024 10:34:37 AM PST by BeauBo
[ Post Reply | Private Reply | To 9869 | View Replies]

To: ETCM
Kyiv Independent reports:

Cargo vessel sent to transport Russian military equipment from Syria breaks down in open sea, Ukraine's intel claims

"The cargo vessel Sparta sent to Syria to bring out Russian military equipment broke down in the open sea and now drifts near the shore of Portugal, Ukraine’s military intelligence (HUR) claimed in a post on Dec. 23.

Concurrently, marine traffic monitors show a Vladivostok-bound cargo ship, Ursa Major, previously registered as Sparta III and visually matching the picture published by HUR, moving at a very low speed of little over 1 knot in the open sea between Spain and Algeria.

"The cargo ship Sparta, which Russia sent to transport its weapons and equipment from Syria, broke down during movement. A fuel pipe of the main engine failed," Ukraine's military intelligence claimed.

"The Russian crew is trying to fix the problem and (the ship) is drifting in the open sea near Portugal.""

9,875 posted on 12/23/2024 10:42:03 AM PST by BeauBo
[ Post Reply | Private Reply | To 9874 | View Replies]

To: AdmSmith; PIF

Today on Telegram, President Zelensky claimed that North Korean casualties have passed 3,000. (maybe just psyops)


9,876 posted on 12/23/2024 10:45:22 AM PST by BeauBo
[ Post Reply | Private Reply | To 9859 | View Replies]

To: FtrPilot

Shi’ite dominated Iraq and Iran have cut off oil shipments to Syria, which is now Sunni dominated. This could possibly drive the new Syrian Government (and Turkey) to seize the Eastern Syria oil fields, currently held by US-backed Kurds.

OilPrice.com reports:

“Iraq has suspended crude oil deliveries to Syria, a member of the Iraqi parliament said on social media as quoted by BNE Intellinews....

...“we remain vigilant about the potential return of terrorist organisations,” (Iraqi Foreign Minister) Hussain said. (still fresh from over 16,000 Iraqi KIA in Iraq’s massive civil war against ISIS, that destroyed huge swathes of Mosul)

Syria has been importing some 120,000 barrels of crude daily from Iraq... The situation will be aggravated by the halt to internal deliveries of crude from eastern Syria, controlled by the Kurdish Syrian Democratic Forces, to the rest of Syria...

...supplies of crude oil from Iran have also ended, with one tanker even making a U-turn en route to the Syrian coast following the news of the change in power in Syria.

Iran was exporting some 60,000 barrels of oil daily to Syria. The country’s own oil production is to the tune of some 80,000 barrels daily, all from eastern Syria, which is under the control of the Kurdish-affiliated Syrian Democratic Forces.

Since the takeover, fuel prices in Syria have skyrocketed, sources from the country told BNE Intellinews, as fuel station stocks run out and transporting gasoline and diesel from Syria’s refineries is challenging due to the transitional situation.”


9,877 posted on 12/23/2024 11:20:03 AM PST by BeauBo
[ Post Reply | Private Reply | To 9865 | View Replies]

To: BeauBo
Sparta in the open sea between Spain and Algeria.

https://www.vesselfinder.com/?imo=9268710

Destination Port Said,Egypt ETA DEC31 20:00 (probably TBU)

9,878 posted on 12/23/2024 12:35:36 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9875 | View Replies]

🚨Update: Zelensky sends out his Army to ‘recruit’ and motivate Ukrainians to join the military…. No GI Bill for these guys… pic.twitter.com/NNHDzxunJ7— US Civil Defense News (@CaptCoronado) December 23, 2024


9,879 posted on 12/23/2024 12:40:12 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9877 | View Replies]

To: BeauBo
This could possibly drive the new Syrian Government (and Turkey) to seize the Eastern Syria oil fields, currently held by US-backed Kurds.

Or it could drive the new Syrian government to make a deal with the Kurds for semi-autonomy. Right now, a conflict with the Kurds would undermine Jolani's promises to the Alawites, Druse, Kurds and Christians, and could cause his government to fall. Plus, a lot of western aid and diplomatic support hinges on the new government respecting the rights of these minorities. Right now, the Kurds are advancing on Manbij, which they ceded to the Turkish backed Syrian National Army just over 2 weeks ago.

9,880 posted on 12/23/2024 12:47:30 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 9877 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,841-9,8609,861-9,8809,881-9,900 ... 18,701-18,703 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson