Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,781-9,8009,801-9,8209,821-9,840 ... 22,201-22,202 next last
To: JonPreston

Putin says that to reduce pornography consumption in Russia, there needs to be content on the internet that's more interesting and compelling. I believe he's referencing the need for more twitter threads about military history. https://t.co/mIC57V7Y77— Big Serge ☦️🇺🇸🇷🇺 (@witte_sergei) December 19, 2024


9,801 posted on 12/20/2024 7:22:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9800 | View Replies]

To: AdmSmith

“The Central Bank, contrary to forecasts, kept the key rate at 21%”

“Putin insinuated that the Russian Central Bank and its head, Elvira Nabiullina, mishandled rising Russian interest rates”

Putin is the Central Bank Chief now. Nabiullina is probably just trying to make it out alive.


9,802 posted on 12/20/2024 7:39:32 AM PST by BeauBo
[ Post Reply | Private Reply | To 9797 | View Replies]

To: BeauBo

Imagine he will do as good a job with central bank as he did being the master strategist


9,803 posted on 12/20/2024 8:06:26 AM PST by blitz128
[ Post Reply | Private Reply | To 9802 | View Replies]

To: blitz128

9,804 posted on 12/20/2024 8:18:15 AM PST by BeauBo
[ Post Reply | Private Reply | To 9803 | View Replies]

To: AdmSmith

Imagine Putin is told that and Steiner is on his way to save the day😂


9,805 posted on 12/20/2024 8:28:47 AM PST by blitz128
[ Post Reply | Private Reply | To 9799 | View Replies]

To: blitz128
Imagine Putin is told that and Steiner is on his way to save the day

Background: That Downfall Scene Explained - What Is Hitler Freaking Out About? 16 Days In Berlin

https://www.youtube.com/watch?v=3Uc4_ATDjoU

Hitler gives Vladimir Putin a call to talk about how the war is going.

https://www.youtube.com/watch?v=mw6lW61y96c

Hitler phones Putin to lecture him, but instead he gets lectured by Putin about 1000 years of Russian history.

https://www.youtube.com/watch?v=BDIw1l3r4tg

9,806 posted on 12/20/2024 9:05:51 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9805 | View Replies]

To: BeauBo; PIF; FtrPilot

U.S. military supply transport flights to Poland with supplies and equipment for Ukraine are back today.


9,807 posted on 12/20/2024 10:10:07 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 9802 | View Replies]

To: marcusmaximus

A couple of explosions around Murmansk.

https://freerepublic.com/focus/f-news/4285583/posts


9,808 posted on 12/20/2024 10:17:20 AM PST by BeauBo
[ Post Reply | Private Reply | To 9807 | View Replies]

To: marcusmaximus

Good news! Thanks for the ping.


9,809 posted on 12/20/2024 10:23:43 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9807 | View Replies]

To: FtrPilot

I think they’re cluster artillery shells on the flight from Turkey, today.


9,810 posted on 12/20/2024 10:26:59 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 9809 | View Replies]

To: marcusmaximus

9,811 posted on 12/20/2024 10:31:44 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9810 | View Replies]

To: JonPreston


9,812 posted on 12/20/2024 10:46:36 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9811 | View Replies]

To: AdmSmith

Love those will watch later


9,813 posted on 12/20/2024 11:10:05 AM PST by blitz128
[ Post Reply | Private Reply | To 9806 | View Replies]

To: marcusmaximus

Kremlin snuff box, 112/20/24
https://t.me/s/kremlin_secrets

Conscripts died in Rylsk

On Friday, December 20, the Ukrainian Armed Forces launched a massive attack on the city of Rylsk in the Kursk region. Officially, authorities reported 6 victims. Among the dead is a child and at least 2 conscripts, our sources say.

We have repeatedly raised the issue of conscript service in border areas. And in general, they said that it was high time to declare the Kursk region a zone of the Northern Military District, or at least equate the participants in the hostilities there with the participants in the Northern Military District. On the direct line, the President said that this would be done. Thank you, Vladimir Vladimirovich, for listening.

Sources do not say what kind of object came under fire in Rylsk. But one of them hinted that there could be more victims. Local public pages even began to spread information that there were military personnel from the DPRK in one of the buildings. Here we responsibly declare that there were no North Koreans in Rylsk. Filter the information, please.


9,814 posted on 12/20/2024 2:53:21 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9810 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, December 20, 2024

Russian ballistic missile strikes damaged several embassies in central Kyiv on the morning of December 20. The Ukrainian Air Force reported that Russian forces launched five Iskander-M/North Korean KN-23 ballistic missiles at Kyiv City on the morning of December 20 and that Ukrainian forces downed all five, but that missile debris damaged infrastructure in Kyiv City and caused civilian casualties.[1] Ukrainian Ministry of Foreign Affairs (MFA) Spokesperson Heorhiy Tykhyi stated that the Russian missile strike damaged multiple embassies in a single building, including the embassies of Albania, Argentina, Montenegro, North Macedonia, Palestine, and Portugal.[2] Kyiv City officials reported that debris from Russian missiles damaged warehouses and infrastructure in Kyiv City.[3] The Ukrainian Air Force reported that Russian forces also launched an Iskander-M ballistic missile, a Kh-59/69 cruise missile, and 65 Shahed and other drones at Ukraine overnight on December 19 to 20, of which Ukrainian air defenses downed 40 drones and electronic warfare (EW) interference caused 20 drones to become lost.[4] The Ukrainian Air Force reported that the overnight drone and missile strikes damaged civilian infrastructure in Dnipropetrovsk, Kharkiv, Kyiv, and Sumy oblasts.

Russian opposition outlet Mediazona reported on December 20 that it has confirmed that at least 20,364 Russian soldiers have been killed in action (KIA) in Ukraine since January 1, 2024.[67] Mediazona noted that Russian KIAs have increased every year of the war and that volunteer servicemembers represented the majority of Russian KIA in 2024. Mediazona reported that the republics of Bashkortostan and Tatarstan suffered the most losses of any Russian federal subject in 2024. Mediazona’s confirmation of Russian KIA in 2024 is likely far below the total Russian KIA suffered this year, as reports from the Ukrainian General Staff indicate that Russian forces suffered over 120,000 casualties (KIA and wounded in action [WIA]) in September, October, and November 2024 alone.[68]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-20-2024

9,815 posted on 12/21/2024 4:27:58 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9793 | View Replies]

1,860 i.e. more than 1.29 Russians and Norks/min


9,816 posted on 12/21/2024 4:39:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9795 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Insane North Korean Tactic Quickly Ends in Disaster ]


Today [ Dec 18, 8 pm ], there is a lot of news from the Kursk direction.

Here, North Korean forces faced their first major combat test in decades, launching a large-scale assault near Kruglyenke under ruthless Russian command. What followed was a brutal Ukrainian demonstration of modern warfare’s unforgiving nature, leaving devastating consequences for the attackers and raising serious questions about their preparedness and tactics.

Last time, we discussed how North Korean soldiers launched a large-scale assault near Kruglyenke with blatant disregard for tactical disadvantages. This approach led to controversial outcomes and devastating losses inflicted by Ukrainian drones and artillery.

As it turned out, the result was far more catastrophic than imagined, with recently released footage revealing the grim aftermath of the failed assault. One video shows more than 2 dozen dead North Korean soldiers lined in the open field for transport, painting a harrowing picture of the chaos and devastation caused by modern precision warfare.

North Korean troops, caught in relentless artillery barrages and targeted drone strikes, were left in disorganized heaps as they attempted to regroup at the forest’s edge.

Many of the fallen lay alongside their wounded comrades, who were given no first aid or evacuation attempts, with the lack of treatment being particularly unsettling.

Footage shows that injured soldiers, often under shock, were abandoned where they fell, treated by their comrades as casualties beyond saving. Some were seen piled into crude clusters, indistinguishable from the dead, as commanders prioritized advancing their forces over providing first aid.

This brutal disregard for the wounded reflects the North Koreans’ outdated tactics, like that of the Russians, where high human cost is a calculated sacrifice.

Reports from Ukrainian soldiers on the ground confirm that the North Koreans do not provide first aid to their wounded. They described a shocking scene where an FPV drone struck a group of 3 soldiers, with 2 falling and not getting up.

Despite showing signs of life, the third looked at them, stood still, and waited for others to arrive before continuing to move forward, with total disregard for the wounded. Other reports described how shells exploded just 20 meters away from groups of soldiers, with them continuing to move at the same pace, without reaction.

The disastrous outcome of the North Korean assault near Kruglyenke can be attributed to a combination of several key reasons.

Firstly, due to time constraints and a lack of resources, North Korean troops received only rudimentary training in modern warfare. The units tasked with their instruction, the Russian VDV and marine brigades, were themselves degraded from months of heavy losses, after countless unsuccessful assaults, with many experienced instructors either dead or otherwise incapacitated. This resulted in unprepared North Korean soldiers being sent into a conflict far beyond their tactical comprehension.

Secondly, further compounding the disaster, was the deliberate use of North Koreans as expendable cannon fodder by the Russian commanders.

They were forced into slow, infantry-only assaults across open fields, without significant artillery or armored support. Instructed to move in [ straight ] lines through dense minefields, they became easy targets for Ukrainian drone surveillance and artillery fire.

The bitter winter conditions only worsened their suffering, with icy terrain hindering movement and making their positions even more conspicuous. Without proper equipment and lacking basic operational understanding, they struggled to navigate the snow and ice, while under relentless attack, as seen in more published videos, reminding of the historical footage of Soviet assaults during World War II.

One Ukrainian drone operator reported that in one instance, a North Korean group became exhausted from walking across the field under fire and sat down to rest, obviously not yet realizing what there is to fear in this unforgiving war.

Overall, the aftermath of the assault marked a catastrophic1st loss for the North Koreans, who may have helped to establish a foothold but exposed their inability to adapt to contemporary warfare.

This operation, meant to bolster Russian efforts in the region, instead served as a stark reminder of the human cost of such outdated tactics, where commanders prioritize attritional gains over their soldiers’ survival. Combining this with insufficient training, an unforgiving environment, and veteran Ukrainian defenders, ensured their failure and devastating losses.


9,817 posted on 12/21/2024 4:55:51 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9816 | View Replies]

To: AdmSmith

Two reports today: one from Dec 19th at 8pm and the second from Dec 20th at 8pm

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ North Koreans Obliterated in Seconds With Cluster Munitions! ]


Today [ Dec 19, 8 pm ], there are a lot of updates from the Kursk direction.

Here, Russian commanders realized that the previous North Korean assaults were costing them dearly and going nowhere; this led to additional meat wave attacks launched in new directions to break through Ukrainian defenses toward Malaya Loknya.

In response, Ukrainians unleashed cluster munitions with ruthless precision, inflicting devastating losses and halting this offensive in the most decisive way possible.

Following the disastrous outcome of North Korean units’ initial engagements near Kruglyenke, the Russian command faced a harsh reality: the human wave tactics they had banked on were not delivering the desired results. With mounting casualties and dwindling morale, it became evident that deploying North Korean troops in isolation was a wasted effort.

Their inadequate training, outdated equipment, and rigid Soviet-style tactics, combined with heavy losses against Ukraine’s layered defenses, made it clear that persisting with the same strategy would lead only to further humiliation and bloodshed.

Acknowledging these limitations, Russian commanders changed their approach, expanding the operational area by shifting focus from Kruglyenke to a broader front that included positions near Novoivanovka, to advance toward the tactically significant village of Malaya Loknya. This adjustment reflected both their desperation and a calculated gamble.

The Russians sought to exploit what they perceived as vulnerabilities in Ukraine’s defensive posture. They aimed to stretch Ukrainian forces and capitalize on weeks of relentless assaults that may have worn down their defenses. This would also put Ukrainian ground lines of communication with Novoivanovka under pressure, destabilize logistics, and possibly isolate Ukrainian soldiers in the village.

The operation, however, was full of challenges. Ukrainian forces maintained intense surveillance of the entire sector, employing drones and well-coordinated defense networks to monitor enemy movements.

While the North Korean troops brought a numerical advantage and a primitive assault doctrine to the battlefield, these benefits were offset by glaring disadvantages.

The attacks relied on narrow vectors, making them highly predictable and vulnerable to concentrated countermeasures. Ukrainian defense units in this sector had already gained significant experience repelling such tactics during the similarly concentrated Russian mechanized assaults on Novoivanovka, forcing Ukrainians to only have to adapt to the lack of armored vehicles used by the North Koreans.

By the time Russian forces unleashed the North Korean troops in the Novoivanovka sector, Ukrainian defenders had fully adapted to the North Korean pure infantry “human wave” assaults. The relentless but predictable nature of these attacks allowed Ukrainian units to refine their defensive strategies, leveraging a combination of entrenched positions, artillery, and modern countermeasures.

Among the most devastating weapons in Ukraine’s arsenal were cluster shells, which once again proved particularly effective against densely packed infantry formations.

Geolocated footage shows that as North Korean troops surged forward in waves, Ukrainian forces deployed cluster munitions with pinpoint accuracy, and with devastating effect. Designed to scatter submunitions over a wide area, these shells proved perfect for countering massed assaults, shredding entire platoons in mere moments.

The resulting devastation was catastrophic, and the psychological toll on the survivors was equally severe, with many reportedly hesitating or refusing to advance after witnessing the carnage. This was a stark contrast to their initial response near Kruglyenke, where they pressed forward despite regular artillery fire.

Overall, the failure of these assaults highlighted the fundamental flaws in the Russian reliance on poorly equipped and trained North Korean forces to achieve tactical objectives.

Military analysts confirmed that extreme losses from around 300 killed and wounded just in the first three to four days of fighting, have forced the North Korean officer staff to already start replenishing their assault groups with personnel from their 94th Separate Brigade, which was still held in reserve.

The rigid and predictable approach of the North Korean units played directly into the Ukrainians’ hands. Combined with strong surveillance and the use of cluster munitions, the expanded Russian front-line assaults near Novoivanovka turned into yet another nightmare.

The relentless Russian and North Korean offensives only served to underscore the growing disparity in tactical sophistication between them and the Ukrainian armed forces.


[ Hospitals Full! North Koreans Suffer Insane Losses! ]


Today [ Dec 20, 8 pm ], there is interesting news from the Kursk direction.

Here, Russians and North Koreans launched a massive front-wide assault in the western Kursk salient, combining their forces in trying to overwhelm Ukrainian defenses, and advance toward Malaya Loknya.

However, the offensive quickly unraveled, as Ukrainian forces leveraged superior tactics, along with precise and devastating firepower, to crush the attackers and decisively repel the combined advance.

After observing that earlier North Korean meat wave assaults enabled small groups of survivors to infiltrate the forest belts northwest of Kruglenkoe, Russian commanders sought to capitalize on this limited success.

Believing these survivors could regroup into more functional assault units for a renewed push toward the tactically significant village of Malaya Loknya, the Russians decided to intensify their offensive. They aimed to exploit the chaos and stretch Ukrainian defenses thin by launching a massive front-wide assault throughout the western Kursk salient.

To achieve this, the Russians opened four axes of advance. North Korean forces were tasked with pushing through the forest northwest of Kruglenkoe and advancing along the tree lines southwest of the village, utilizing their numerical advantage in hopes of overwhelming Ukrainian positions.

Meanwhile, Russian units concentrated their efforts on the villages of Novoivanovka and Darino, critical points for controlling the surrounding terrain and linking their operations. Together, these coordinated thrusts aimed to encircle Ukrainian forces, disrupt their defensive lines, and secure a breakthrough toward Malaya Loknya, slicing off a massive portion of the Ukrainian Kursk salient in the process.

This operation had a clear objective: to overwhelm Ukrainian defenders by launching simultaneous attacks from multiple directions, forcing them to stretch their resources and manpower thin. However, the terrain posed significant challenges.

At Darino, Russian forces were forced to cross a river, complicating movement and coordination.

At Novoivanovka, they had to cross open roads which were heavily mined during the night by Ukrainian drones. With its mix of snow and rain, winter weather added another layer of complexity.

Poor visibility partially limited Ukrainian drone operations, reducing the precision of their surveillance and artillery strikes. Yet the same was true for the Russians, as these conditions hindered them and the North Koreans even more, slowing their advances, increasing disorganization, and leaving them vulnerable to well-timed Ukrainian counterattacks.

Unfortunately for the Russians, their forces turned out to be even less successful than the North Koreans.

Near Darino, the Russians attempted to exploit local roads and support their infantry with lightly armored vehicles, which were quickly targeted and stopped by the Ukrainians as soon as the weather cleared. Russian soldiers dispersed into the local tree lines to seek cover but were spotted by the drone operators and destroyed with artillery and FPV strikes.

The Russian assault on Novoivanovka was even more heavily supported, with tanks and armored personnel carriers advancing rapidly while attempting to use local tree belts as cover. However, their assumption that the Ukrainian defenders were worn down from weeks of relentless fighting could not be further from the truth.

Nearly all the vehicles were obliterated by mines, laid by Ukrainian sappers, who meticulously restored these obstacles with drones after every Russian wave. This shows the outstanding performance of Ukrainian engineers in maintaining and renewing defensive measures, allowing defenses not to be worn out by constant attacks.

Near Kruglenkoe, the North Koreans established a limited presence in the forest, but were under constant Ukrainian drone surveillance. So, as they gathered together for an attack on the village, they were immediately targeted by Ukrainian artillery armed with conventional and cluster rounds.

Once the shells dispersed the initial concentration of North Korean soldiers, some of them ran back to the tree lines for cover. Ukrainians then deployed FPV drones, to hunt the remaining forces down, effectively nullifying their contingent.

Overall, the combined Russian and North Korean front-wide assault collapsed under the weight of their extreme losses. Russian sources published footage from hospitals in Kursk, where over a 100 wounded North Korean soldiers had been evacuated to for treatment.

Once again, Ukrainian resilience and tactical superiority proved decisive, as Ukrainians deployed concentrated firepower and landmines on key points of the Russian and North Korean advance, while conducting a well-coordinated defense to neutralize the attackers, forcing them to retreat.


9,818 posted on 12/21/2024 5:14:13 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9816 | View Replies]

To: PIF; AdmSmith
🔥 Russia: The fascists complain the fire rages into the night in Rylsk following Ukrainian HIMARS strikes at a "teacher college" because ammunition continues to detonate.

https://x.com/igorsushko/status/1870258574284468280


9,819 posted on 12/21/2024 6:14:34 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9818 | View Replies]

To: PIF; AdmSmith
FTA: ...Once again, Ukrainian resilience and tactical superiority proved decisive, as Ukrainians deployed concentrated firepower and landmines on key points of the Russian and North Korean advance...

Kudos to UKF intel. Their ability to predict what ruzzia will do is amazing.

Or perhaps the ruzzians have no OPSEC/COMSEC.

Perhaps a combination of both.

We see many x.com blog posts documenting UKF success.

9,820 posted on 12/21/2024 6:28:07 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9818 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,781-9,8009,801-9,8209,821-9,840 ... 22,201-22,202 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson