Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,741-9,7609,761-9,7809,781-9,800 ... 22,161-22,176 next last

Russia to cure cancer?

Russia says it developed a therapeutic mRNA "vaccine" against cancer and it will be distributed to patients "free of charge."

pic.twitter.com/TH5YyCxJ6Q— Lord Bebo (@MyLordBebo) December 18, 2024


9,761 posted on 12/18/2024 5:46:41 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9760 | View Replies]

To: blitz128

Will be interesting if reports of 100,000 norks comes to pass. Imagine Putin is pressing for more equipment as well,

10,000 not 100,000.

Kim Un is the one pressing for more equipment, namely SU-34s and SU-35s, missile parts, and nuclear bomb making skills and equipment.


9,762 posted on 12/18/2024 6:13:44 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9760 | View Replies]

To: PIF

Heard a report that they may send 100k is what I was referring to, and it wouldn’t surprise me, Kim would trade souls for tech in a heart bear, theirs


9,763 posted on 12/18/2024 8:22:42 AM PST by blitz128
[ Post Reply | Private Reply | To 9762 | View Replies]

To: BeauBo
A day after Russian railways announces they will miss profit projections by a staggering -90%, another train derailment.

Life in Putin's hellscape only gets dirtier for the filthy savages as they wait their turn to go to Ukraine.

Murmansk.

https://x.com/JayinKyiv/status/1869389955233173905


9,764 posted on 12/18/2024 9:30:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9756 | View Replies]

To: AdmSmith

Russia moving Equipment from Syria to Libya, as predicted.

https://x.com/sentdefender/status/1869422594757210523

So Turkey wins the Syrian proxy war with Russia. Of course, Turkey and Russia are fighting another proxy war in Libya. That one is currently frozen. Turkey used Syrian fighters in Libya. With Assad, Russia and Hezbollah chased out of Syria, Turkey might decide that once Syria is stabilized, they can refocus some of these same forces in Libya.


9,765 posted on 12/18/2024 11:07:58 AM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 9759 | View Replies]

To: PIF
Russian aviation affiliated channel Fighterbomber with another mourning message.

Apparently Russian air defense shot down one of their own helicopters.

https://x.com/NOELreports/status/1869449524697313701

I wonder where the shoot down occurred.

9,766 posted on 12/18/2024 11:21:52 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9764 | View Replies]

To: ETCM

“Russia moving Equipment from Syria to Libya.”

Time to engage the Diplomatic and Intelligence Communities, to ensure that this is just a temporary staging area, on that equipment’s journey back to Russia, or to hell.


9,767 posted on 12/18/2024 1:16:52 PM PST by BeauBo
[ Post Reply | Private Reply | To 9765 | View Replies]

To: BeauBo

“back to Russia, or to hell.”

You are repeating yourself😂


9,768 posted on 12/18/2024 1:23:45 PM PST by blitz128
[ Post Reply | Private Reply | To 9767 | View Replies]

To: blitz128
Kim would trade souls for tech in a heart bear

translation please.

9,769 posted on 12/18/2024 4:00:19 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9763 | View Replies]

To: blitz128; PIF

I suspect Kim would be happy to trade for the heart of the bear. I hear bear meat is good eating. ;-)


9,770 posted on 12/18/2024 7:39:58 PM PST by gleeaikin (in Question authority as you provide links)
[ Post Reply | Private Reply | To 9763 | View Replies]

To: blitz128

“back to Russia, or to hell.”

“You are repeating yourself😂”

Good one. Made me laugh.


9,771 posted on 12/18/2024 7:46:03 PM PST by BeauBo
[ Post Reply | Private Reply | To 9768 | View Replies]

To: blitz128; FtrPilot; marcusmaximus

Ukrainian drones and missiles set Russia ablaze again. Another night of fireworks for the invaders.

Kyiv Independent reports:

“The Kamensky Combine, one of the largest chemical plants in Russia, was hit in an attack on Rostov Oblast, Andrii Kovalenko, head of Ukraine’s counter-disinformation center, claimed on Dec. 18. The factory produces rocket fuel (including fuel for intercontinental ballistic missiles) components of ammunition and explosives, Kovalenko said.”

And...

“A fire broke out at the Novoshakhtinsk oil refinery in Russia’s Rostov Oblast in the early hours of Dec. 19 following a mass drone and missile attack, Yuri Slyusar, acting governor of Rostov Oblast said.

Explosions initially rang out near the oil refinery just after midnight, the Russian Telegram news channel Astra reported, citing eyewitnesses. The outlet also posted video footage of the site in flames.

Slyusar wrote on Telegram that a fire had broken out at the refinery following a mass Ukrainian aerial attack which allegedly included “over three dozen” drones as well as three missiles.

Firefighters are currently on-scene attempting to extinguish the large blaze, Slyusar added...

...Ukraine has previously targeted the Novoshakhtinsk oil refinery with drone strikes. The General Staff of Ukraine’s Armed Forces claimed that a July attack on the refinery destroyed 1.5 million tons of oil and oil products worth $540 million.

The refinery partially shut down after an attack in March.”


9,772 posted on 12/18/2024 8:10:26 PM PST by BeauBo
[ Post Reply | Private Reply | To 9768 | View Replies]

To: blitz128; FtrPilot; marcusmaximus

Ukrainian drones and missiles set Russia ablaze again. Another night of fireworks for the invaders.

Kyiv Independent reports:

“The Kamensky Combine, one of the largest chemical plants in Russia, was hit in an attack on Rostov Oblast, Andrii Kovalenko, head of Ukraine’s counter-disinformation center, claimed on Dec. 18. The factory produces rocket fuel (including fuel for intercontinental ballistic missiles) components of ammunition and explosives, Kovalenko said.”

And...

“A fire broke out at the Novoshakhtinsk oil refinery in Russia’s Rostov Oblast in the early hours of Dec. 19 following a mass drone and missile attack, Yuri Slyusar, acting governor of Rostov Oblast said.

Explosions initially rang out near the oil refinery just after midnight, the Russian Telegram news channel Astra reported, citing eyewitnesses. The outlet also posted video footage of the site in flames.

Slyusar wrote on Telegram that a fire had broken out at the refinery following a mass Ukrainian aerial attack which allegedly included “over three dozen” drones as well as three missiles.

Firefighters are currently on-scene attempting to extinguish the large blaze, Slyusar added...

...Ukraine has previously targeted the Novoshakhtinsk oil refinery with drone strikes. The General Staff of Ukraine’s Armed Forces claimed that a July attack on the refinery destroyed 1.5 million tons of oil and oil products worth $540 million.

The refinery partially shut down after an attack in March.”


9,773 posted on 12/18/2024 8:10:26 PM PST by BeauBo
[ Post Reply | Private Reply | To 9768 | View Replies]

To: BeauBo

Diane Francis in the Kyiv Post:

“Only 5% of the Pentagon budget has destroyed 50% of Russia’s army.

Now, the world witnesses Moscow’s exit from Syria, with its tail between its legs and humiliation reminiscent of its 1989 exit from Afghanistan. That debacle resulted in the collapse of the government and the dissolution of the Soviet Union into 15 independent countries. Syria and Ukraine are Putin’s “Afghanistan” and will hopefully accelerate the dissolution of the Russian Federation into many independent countries.

That would be a triumph for the world and mark the end of Europe’s last odious empire.”


9,774 posted on 12/18/2024 8:12:34 PM PST by BeauBo
[ Post Reply | Private Reply | To 9773 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, December 18, 2024

Russian Chief of the General Staff Army General Valery Gerasimov heavily inflated alleged statistics about Russian territorial gains in 2024. Gerasimov claimed on December 18 that Russian forces seized roughly 4,500 square kilometers in 2024.[8] ISW has observed confirmation that Russian forces have only seized 3,306 square kilometers in 2024, however. Gerasimov’s exaggerated figures contrast with Russian Defense Minister Andrei Belousov’s more accurate statements to the Russian Ministry of Defense (MoD) board meeting on December 16. Belousov claimed, for example, that Russian forces’ average daily rate of advance is about 30 square kilometers.[9] ISW observed geolocated evidence to assess that Russian forces advanced at a rate of roughly 27.96 square kilometers per day in November 2024.[10] Belousov also claimed that Russian forces have seized roughly 99 percent of Luhansk Oblast, 70 percent of Donetsk Oblast, roughly 74 percent of Zaporizhia Oblast, and roughly 76 percent of Kherson Oblast.[11] ISW assesses that Russian forces occupy roughly 99 percent of Luhansk Oblast, 66 percent of Donetsk Oblast, and 73 percent of Zaporizhia and Kherson oblasts each.

The Russian Ministry of Defense (MoD) is increasingly tricking conscripts into signing military service contracts to fight in Ukraine likely in an effort to generate more assault forces and maintain the tempo of Russian offensive operations in Ukraine. Radio Free Europe/Radio Liberty's Tatar-Bashkir Service Idel Realii reported on December 18 that the parents of Russian conscripts serving in a Russian military unit in Chebarkul, Chelyabinsk Oblast wrote an appeal to submit to Russian President Vladimir Putin's Direct Line engagement on December 19, claiming that the Russian military has coerced and forced their children into signing Russian military service contracts.[79] Russian opposition outlet Mobilization News reported on December 18 that a Russian conscript from Pskov Oblast recently died in occupied Zaporizhia Oblast due to unknown causes.[80]

Ukrainian military observer Petro Chernyk stated on December 18 that Ukrainian forces have damaged and destroyed up to 28 Russian surface ships since the start of Russia's full-scale invasion of Ukraine in February 2022.[83] Chernyk added that Ukrainian forces have damaged and destroyed 10 of the Russian Black Sea Fleet's (BSF) 15 landing ships but that the BSF still has 20 Kalibr cruise missile carriers in service. Chernyk also stated that destroying landing-class ships is particularly important because Russia relies on these ships to transport supplies to occupied Crimea, and Russia is no longer capable of building landing-class ships. Ukrainian Navy Spokesperson Captain Third Rank Dmytro Pletenchuk reported in February 2024 that the BSF had almost 80 pieces of naval combat equipment at the start of Russia's full-scale invasion of Ukraine.[84]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-18-2024

9,775 posted on 12/19/2024 12:15:22 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9757 | View Replies]

1 530, i.e. more than 1.06/min. How many Norks?
9,776 posted on 12/19/2024 12:18:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9759 | View Replies]

To: FtrPilot

“A fire broke out at the Novoshakhtinsk oil refinery in Russia’s Rostov Oblast in the early hours of Dec. 19 following a mass drone and missile attack”

Reportedly, this was the last oil refinery still operating in Krasnodar Krai. Maybe now, not so much.

“The fire also affected the refinery’s ELOU-AVT-2.5 catalytic cracking unit, according to the General Staff.”


9,777 posted on 12/19/2024 2:00:11 AM PST by BeauBo
[ Post Reply | Private Reply | To 9773 | View Replies]

To: ETCM

Just a random taxi driver in Moscow

https://www.instagram.com/reel/DDhAG5qsmlQ/


9,778 posted on 12/19/2024 3:05:51 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9765 | View Replies]

To: AdmSmith

Singing something about Assad, but what?


9,779 posted on 12/19/2024 5:50:40 AM PST by BeauBo
[ Post Reply | Private Reply | To 9778 | View Replies]

To: BeauBo
No Neocons Need Apply

CNN: Tucker Carlson's efforts prevented Mike Pompeo from getting cabinet job, WSJ reporter says— Election Wizard (@ElectionWiz) December 19, 2024


9,780 posted on 12/19/2024 7:13:25 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9779 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,741-9,7609,761-9,7809,781-9,800 ... 22,161-22,176 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson