Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,721-9,7409,741-9,7609,761-9,780 ... 22,141-22,145 next last
To: BeauBo
In the Zaporizhzhia direction, a unit of the 3rd Special Operations Regiment demolished a building where Russians were hiding, destroyed a concealed enemy vehicle, and struck a military-purpose golf cart.

https://x.com/wartranslated/status/1869063059165299206


9,741 posted on 12/17/2024 12:06:31 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9740 | View Replies]

To: PIF
🇷🇺 Ecological disaster.

The situation in the Kerch Strait is worsening due to a fuel oil spill after three Russian tankers were damaged and sunk, leaving huge amounts of oil spilled in the water...

https://x.com/NOELreports/status/1869095495785996417


9,742 posted on 12/17/2024 12:10:22 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9741 | View Replies]

To: ETCM; FtrPilot

Ukraine continues on an accelerated accession timeframe into the EU. The express lane. In several significant economic, financial and political ways; they are already effectively in.

Kyiv Independent reports:

“President Volodymyr Zelensky said on Dec. 17 that Ukraine aims to open all negotiating clusters with the European Union in 2025, an ambitious step in the country’s EU accession process, Interfax-Ukraine reported.

“During Poland’s EU presidency, we expect to open at least two clusters and six in total. To be honest, our goal is very ambitious — to open all the clusters next year,” Zelensky said at the All-Ukrainian Congress of Local and Regional Authorities.

The EU’s Commissioner for Enlargement, Oliver Varhelyi, has said Ukraine could join the bloc by 2029, provided it completes the necessary reforms.”


9,743 posted on 12/17/2024 12:10:55 PM PST by BeauBo
[ Post Reply | Private Reply | To 9646 | View Replies]

To: FtrPilot; PIF

“🇷🇺 Ecological disaster... The situation in the Kerch Strait”

Looks like the oil spill is hitting the Russian coastline in Krasnodar Krai - dozens of kilometers of coastline, including Anapa.

https://www.themoscowtimes.com/2024/12/17/oil-spill-washes-up-on-russias-black-sea-coast-after-storm-hits-aging-tankers-a87364


9,744 posted on 12/17/2024 12:20:37 PM PST by BeauBo
[ Post Reply | Private Reply | To 9742 | View Replies]

To: BeauBo
Speedy is dead, Part II

What a maroon!


To: JonPreston

You are a disrespectful troll, a disgrace to the parents that raised you, for disparaging our fellow Freeper who served his Country honorably, and is no longer with us.

9,649 posted on 12/15/2024 11:18:48 AM PST by BeauBo

9,745 posted on 12/17/2024 12:24:58 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9740 | View Replies]

To: JonPreston

Speedy is no longer with us, maroon.


9,746 posted on 12/17/2024 12:31:31 PM PST by BeauBo
[ Post Reply | Private Reply | To 9745 | View Replies]

To: JonPreston

What a maroon!


Maroon (US/UK mə-ROON, Australia mə-ROHN) is a brownish crimson color that takes its name from the French word marron, meaning chestnut. Marron is also one of the French translations for “brown”.


9,747 posted on 12/17/2024 12:42:25 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9745 | View Replies]

To: PIF
Zeepers have zero sense of humor.

Absolutely ZERO!


9,748 posted on 12/17/2024 1:31:02 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9747 | View Replies]

🚨ZELENSKY TO THE WEST: UKRAINE NEEDS URGENT BACKUP, NOW!

Zelensky is urging international allies to immediately boost aid as Ukrainian troops face intense pressure from better-equipped Russian forces.

With leaders gathering in Brussels this week, Zelensky made it clear:… pic.twitter.com/x89QKRG03O— Mario Nawfal (@MarioNawfal) December 17, 2024


9,749 posted on 12/17/2024 1:33:02 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9748 | View Replies]

The Zelensky Curse got Freeland, possibly entire Liberal govt.

pic.twitter.com/f7aFtiHvKZ— Chebureki Man (@CheburekiMan) December 17, 2024


9,750 posted on 12/17/2024 1:35:19 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9749 | View Replies]

It's Over

🚨BREAKING: Trump REFUSES to invite Zelensky to inauguration.

pic.twitter.com/CHEbMBXW42— Legitimate Targets (@LegitTargets) December 17, 2024


9,751 posted on 12/17/2024 1:38:58 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9750 | View Replies]

To: JonPreston

Excellent. 👍


9,752 posted on 12/17/2024 1:49:46 PM PST by ANKE69 (✌️🇺🇲 Let's MAGA)
[ Post Reply | Private Reply | To 9751 | View Replies]

To: BeauBo

Please ignore Preston. When he can draw you out he just feels he is proving his power over us.


9,753 posted on 12/17/2024 6:34:59 PM PST by gleeaikin (in Question authority as you provide links)
[ Post Reply | Private Reply | To 9740 | View Replies]

To: gleeaikin; PIF; FtrPilot; ETCM; AdmSmith

General Kellogg to make the rounds in Europe and Kyiv in January, fact finding before Inauguration Day.

Kyiv Independent reports:

“The Trump administration’s incoming Ukraine peace envoy, Keith Kellogg, plans to visit Kyiv and several European capitals in early January as part of the new administration’s effort to address the Russia-Ukraine war, two sources familiar with the matter told Reuters.

Kellogg, who will serve as President-elect Donald Trump’s special envoy for Ukraine and Russia, does not intend to travel to Moscow during this trip, the sources said. Instead, he will hold discussions with senior Ukrainian leaders in Kyiv.

Kellogg’s team is also arranging meetings in other European cities, including Rome and Paris, though the itinerary remains subject to change, one source added.

The meetings are expected to focus on “fact-finding” to inform the incoming Trump administration, rather than launching formal negotiations, according to the sources.”


9,754 posted on 12/17/2024 7:12:18 PM PST by BeauBo
[ Post Reply | Private Reply | To 9753 | View Replies]

To: BeauBo

Kyiv Post reports:

You Kick Out Russians, We Lift Sanctions, EU Hints to Syrian Authorities

https://www.kyivpost.com/post/44050


9,755 posted on 12/17/2024 7:14:14 PM PST by BeauBo
[ Post Reply | Private Reply | To 9754 | View Replies]

To: BeauBo
John Hinderacker reports that US Companies now account for 65% of total global stock market capitalization. Russia is nowhere in the top twenty - maybe a footnote somewhere.


9,756 posted on 12/17/2024 7:35:43 PM PST by BeauBo
[ Post Reply | Private Reply | To 9755 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, December 17, 2024

The Kremlin and Russian propagandists overwhelmingly attempted to frame Kirillov’s assassination as an unprovoked terrorist act, rather than a consequence of Russia's full-scale invasion of Ukraine and Kirillov’s responsibility for Russian chemical weapons attacks and information operations against Ukraine. Petrenko announced that Sledkom designated Kirillov’s and Polokarpov’s deaths as a terrorist act, and Russian officials such as Ministry of Foreign Affairs (MFA) Spokesperson Maria Zakharova emphasized Kirillov’s prominent role in spreading numerous (false) narratives about Ukraine's and NATO's alleged use of chemical and biological weapons.[5] Kirillov spread several false narratives over the years, such as nonsensically claiming that the United States established “biolabs” in Ukraine and other countries around Russia and that the Pentagon deliberately destroyed the Kakhovka Hydroelectric Power Plant (KHPP) to spread contagious diseases via insects.[6] The Kremlin notably used the false claims of Ukrainian use of biolabs as a pretext for Russia's full-scale invasion of Ukraine.[7] Federation Council Committee of Defense and Security Member Vladimir Chizhov among other Russian officials and propagandists claimed that Western and Ukrainian security officials hated Kirillov for “exposing” Western provocations in Russia.[8]

The Russian Ministry of Defense (MoD) is increasingly tricking conscripts and civilians into signing military service contracts to fight in Ukraine in an effort to generate more assault forces. Radio Free Europe/ Radio Liberty's Tatar-Bashkir Service Idel Realii shared stories of several Russian conscripts whom Russian authorities coerced into signing military contracts or had their military contracts falsified.[89] Idel Realii reported that a Russian lieutenant killed a conscript, and relatives of the conscript claimed that he was killed after Russian recruiters unsuccessfully attempted to coerce the conscript into signing a military service contract.

Moscow City is reportedly failing to meet its conscription quotas for the Fall 2024 conscription cycle, which may indicate that the Russian military still faces problems with draft dodging despite increasing emphasis on military-patriotic education and adoption of stricter conscription measures. Moscow City Military Recruitment Head Maksim Loktev announced on December 17 that Moscow completed its conscription processes two weeks earlier than expected and claimed that Moscow fully met its conscription goals as a result of growing patriotic sentiment among Russian young men.[90] Russian lawyer of the “Movement of Conscious Objectors” Artem Klyga stated that conscription is ongoing in Moscow and that Moscow is unlikely to have met its quota of conscripting 8,000 men.[91]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-17-2024

9,757 posted on 12/17/2024 11:17:58 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9703 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ What AreThey Doing? North Koreans Just Run Through the Fields ]


Today [ Dec 17, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, the Russians, unable to intensify their attacks, sent in North Korean soldiers to open a new axis of advance. Tasked with clearing a path for Russian troops, the North Koreans quickly faltered against veteran Ukrainian defenders, being woefully unprepared for the realities of modern combat.

The Russian offensive goal is to take Malaya Loknya, with Russian forces concentrated in 2 axes of attack at Pogrebki and Novoivanivka. By attacking from these 2 directions, Russians hope to encircle a large group of Ukrainian forces located in the northwestern forests, and split off a significant chunk of the Ukrainian Kursk salient.

As you know, Russians have already suffered heavy casualties in these 2 axes of advance, with little to no progress to show for it. This caused Russians to lack the additional forces needed to intensify operations outside their efforts at Novoivanovka and Pogrebki. This meant that after weeks of training and integration into Russian VDV and marine brigades, it was finally time to send in the North Korean soldiers, to see what they were made of.

The forests that the Russians selected for the 1st North Korean attack could serve as a staging ground for a flanking attack against the Ukrainian positions north of Novoivanivka, mutually supporting the main Russian effort to advance to Malaya Loknya.

Furthermore, if we look at the topographic map, we can see that the forest is located in the lowlands, in a branch of the Malaya Loknya River. Here, the North Koreans would attempt to move from the hills into the forests below, advancing slowly on the town of Kruglyenke.

By stretching the Ukrainian forces in the forest and Kruglyenke, the Russians and North Koreans would be able to join their 2 axis of advance for a combined offensive on Malaya Loknya.

Based on their obsolete experience from the Korean War, North Korean tactics required their assault formations to accumulate a large number of forces in preparation for overwhelming infantry-based attacks.

North Korean soldiers were meant to serve as the 1st wave of the Russian attack towards the forest, establishing a foothold and clearing the way for Russian soldiers to advance in after them. The start of this assault was officially marked by many as the 1st engagement of the North Korean Army in 70 years, since the Korean War ended in a ceasefire.

Combat footage from the area shows a pure-infantry assault involving up to fifty North Korean stormtroopers. North Korean commanders directed their forces to advance in columns toward the forest, to minimize casualties from Ukrainian landmines. However, the attackers were largely unprepared for modern drone warfare.

Despite some training, North Korean forces remained unfamiliar with the impact of drone surveillance and precision strikes, which seemed unrealistic to them. This lack of preparedness allowed drone-corrected artillery fire and targeted drone strikes to catch them completely off guard.

The survivors who managed to cross the fields were left disorganized, and as they grouped up at the forest’s edge, they became easy targets for continued Ukrainian drone strikes. Disturbingly, several North Korean soldiers were seen pleading with Ukrainian drone operators for their lives.

In the end, the North Korean attack failed to achieve its objective of facilitating a swift advance toward Malaya Loknya, resulting in a decisive and costly failure.

Overall, the North Koreans suffered catastrophic losses near Kruglyenke in their attempt to establish a tactical bridgehead in the forest. These losses were primarily due to their complete lack of familiarity with the dynamics of modern warfare, where drones play a decisive role, inflicting a majority of their casualties.

Despite these setbacks, the bridgehead created by the North Koreans now provides the main Russian force with a staging ground for further advances toward Kruglyenke.

The 3rd axis of advance, formed by a joint effort between North Korean and Russian units, is likely to turn into yet another disastrous kill zone. This reflects Russian desperation to gain control of Malaya Loknya, while the heavy losses sustained by the North Koreans foreshadows further disaster for the highly anticipated future assaults.


9,758 posted on 12/18/2024 4:04:35 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9756 | View Replies]

1 580 how many Norks?


9,759 posted on 12/18/2024 4:39:32 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9708 | View Replies]

To: PIF

Will be interesting if reports of 100,000 norks comes to pass. Imagine Putin is pressing for more equipment as well, guess demilitarization of Russia is not enough, next will be NK.😎


9,760 posted on 12/18/2024 5:13:53 AM PST by blitz128
[ Post Reply | Private Reply | To 9758 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,721-9,7409,741-9,7609,761-9,780 ... 22,141-22,145 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson