Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,581-9,6009,601-9,6209,621-9,640 ... 18,521-18,531 next last
To: JonPreston

9,601 posted on 12/14/2024 2:52:41 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9600 | View Replies]

To: PIF

The usual is still shouting about Russian GDP, lol

How much “gdp” did they launch a few days ago?


9,602 posted on 12/14/2024 3:20:06 PM PST by blitz128
[ Post Reply | Private Reply | To 9580 | View Replies]

To: blitz128

9,603 posted on 12/14/2024 3:35:07 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9602 | View Replies]

To: JonPreston

‼️BREAKING:

⚡The Ukrainian GUR has released the first footage of North Korean soldiers taking part in the SMO.

If you look closely, you can see the Korean patch.

If you don't see it you are a Russian propagandist.

pic.twitter.com/C8XYHKwfLE— Spetsnaℤ 007 🇷🇺 (@Alex_Oloyede2) December 14, 2024


9,604 posted on 12/14/2024 3:41:57 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9603 | View Replies]

To: gleeaikin; BeauBo; PIF
Russian Offensive Campaign Assessment, December 14, 2024

Ukrainian President Volodymyr Zelensky stated on December 14 that the Russian military had deployed North Korean soldiers in infantry assaults in Kursk Oblast.[1] Zelensky stated that the Russian military is incorporating “a significant number” of North Korean soldiers into Russian units operating in Kursk Oblast and that North Korean soldiers have already sustained “noticeable” losses. Zelensky noted that Russian forces have only deployed North Korean soldiers to offensive operations in Kursk Oblast but may use them in other unspecified areas of the frontline in the future. This is the first time a Ukrainian official has reported that North Korean forces are conducting assault operations since Ukrainian Defense Minister Rustem Umerov announced in an interview with South Korean national broadcaster KBS on November 5 that Ukrainian forces engaged in “small-scale” clashes with North Korean troops in Kursk Oblast.[2] Russian milbloggers recently acknowledged that North Korean forces are involved in assaults in Kursk Oblast and claimed on December 12 and 13 that North Korean soldiers participated in the seizure of Plekhovo (south of Sudzha) on December 6.[3] Several Russian milbloggers claimed that North Korean special forces seized Plekhovo with no assistance from Russian forces, but one milblogger characterized the assault as a joint Russian-North Korean operation.[4] Geolocated footage published on December 14 shows roughly 40 infantry personnel conducting an assault east of Kremyanoye (east of Korenevo), and some sources claimed that the footage shows North Korean troops, although ISW cannot independently verify if the footage shows North Korth or Russian personnel.[5] A Russian milblogger claimed on December 14 that elements of the Russian 1427th Motorized Rifle Regiment (a mobilized element of the Russian Territorial Troops) advanced near Russkoye Porechnoye (north of Sudzha) with support from North Korean personnel.[6] A Russian milblogger claimed that elements of the Russian 22nd Motorized Rifle Regiment (72nd Motorized Rifle Division, 44th Army Corps [AC], Leningrad Military District [LMD]), 810th Naval Infantry Brigade (Black Sea Fleet [BSF], Southern Military District [SMD]), and “Arbat” Special Purpose Battalion (Donetsk People's Republic [DNR] “Pyatnashka” International Volunteer Brigade, 51st Combined Arms Army [CAA]) trained North Korean personnel operating in Kursk Oblast for “many weeks.”[7] Ukrainian defense outlet Militarnyi amplified several Ukrainian sources on December 14 claiming that North Korean soldiers conducted infantry assaults across open terrain in groups of 20 to 30 personnel in unspecified areas in Kursk Oblast.[8] ISW cannot independently verify any of these claims, however. ISW previously noted that North Korea's ability to learn and integrate lessons from fighting alongside Russia is likely to be significantly degraded if the Russian military command uses North Korean troops in the same highly attritional infantry-led assaults that it uses most Russian personnel.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-14-2024

9,605 posted on 12/15/2024 4:05:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9594 | View Replies]

1 280, incl Norks
br>

9,606 posted on 12/15/2024 4:21:16 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9595 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Fire From The Shadows: Ukrainians Show Marksman Masterclass ]


Today [ Dec 14, 8 pm ], there are a lot of important updates from the Toretsk [ north of Donetsk ] direction.

Here, the battle for Toretsk has taken a new turn as Russian forces attempted to encircle the town by penetrating the northern flank, believing they had found a weak spot. Instead, they were met with devastating sniper fire from concealed Ukrainian positions, turning their advance into a lethal venture.

After enduring months of costly and largely unsuccessful assaults in Toretsk’s urban center, Russian generals shifted their focus to the town’s flanks. The brutal urban battles had yielded minimal territorial gains at the cost of over a 100 soldiers daily - losses that could no longer be justified.

By concentrating on flanking maneuvers, Russian commanders sought to reduce casualties and achieve control over Toretsk with less intense combat. The primary axis of this flanking operation targeted the northern outskirts of the town.

The Russian objective on Toretsk’s northern flank is to seize the village of Dyiilivka by advancing along the railway embankment, while simultaneously leveraging the tree lines east of the railways to support their assault.

Capturing and consolidating control over Dyiilivka would enable Russian forces to bypass Toretsk’s main defenses and attack the town from the north.

Such a maneuver would allow the Russians to push across open fields toward Toretsk’s primary supply road, jeopardizing Ukrainian logistics and potentially forcing a withdrawal from the town.

However, despite repeated assaults, Russian forces have thus far failed to breach the Ukrainian defenses or achieve any progress along the railway embankment.

This is because the Russian advance along the railway embankment from their staging ground in Druzhba has become highly predictable. Ukrainian commanders anticipated that Russian forces would rely on the treelines and grooves near the railway embankment as their primary avenues of attack.

These paths were the most logical choices for the Russians, as attempting to traverse the open fields would leave their assault units dangerously exposed to concentrated Ukrainian fire, rendering such an approach unviable for sustained offensive operations.

Ukrainian control over Dyiilivka and Dachne has been pivotal in countering Russian advances along the railway embankment. These villages have been fortified into robust defensive strongholds, facilitating seamless troop rotations, the stockpiling of ammunition, and the establishment of strategic firing positions.

With Ukrainian drone surveillance providing real-time intelligence, Russian assault forces are consistently detected and neutralized well before they can approach Ukrainian defensive lines, ensuring the continued resilience of these key positions.

Russian assaults typically begin with sabotage and reconnaissance groups probing Ukrainian defenses to gather critical intelligence for the main attack force.

Without this preliminary reconnaissance, the main Russian units would face significant risks of advancing blindly into fortified Ukrainian positions, resulting in devastating losses.

The predictability of Russian scouting and assault routes has allowed Ukrainian forces to strategically deploy snipers along the eastern flanks of Dyiilivka and Dachne, effectively neutralizing these probing elements and disrupting subsequent attack plans.

The terrain in front of Dachne is characterized by open fields spanning half a kilometer to a full kilometer, interspersed with narrow treelines that Russian troops use for movement.

These open expanses create ideal conditions for Ukrainian sniper teams, who excel against small infantry groups attempting to traverse such exposed areas. The Ukrainian snipers, expertly concealed within a small forest near Dachne, employ advanced camouflage techniques to blend seamlessly with the terrain, rendering them nearly invisible even at close range.

These snipers maintain control over large swaths of the battlefield, their precision fire eliminating Russian reconnaissance units that lack the range or capability to retaliate effectively.

Combat footage from the area showcases the lethal effectiveness of these snipers, who have systematically neutralized Russian scouts attempting to cross the fields and treelines, thereby preventing any follow-up assaults from gaining momentum.

Overall, the Russian offensive north of Toretsk ultimately faltered due to the constrained attack routes, which severely limited maneuverability and allowed Ukrainian forces to swiftly detect and eliminate Russian scout units before the main assaults could gain traction.

These failures repeatedly stalled Russian advances, demonstrating to their commanders that achieving meaningful progress in this sector was unattainable, without diverting significant manpower and equipment from the main offensive effort within Toretsk itself.

Confronted with the impracticality of continued assaults on the Northern flank, the Russian command abandoned this efforts redirecting their focus to other areas, trying to find opportunities for a breakthrough.


9,607 posted on 12/15/2024 4:39:43 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9599 | View Replies]

To: PIF

Interesting analysis of RT on Syria
https://m.youtube.com/watch?v=Z9Y5hUIplyI


9,608 posted on 12/15/2024 5:33:26 AM PST by blitz128
[ Post Reply | Private Reply | To 9607 | View Replies]

Good Morning Thread, where is everyone?

The same Klowns who have been running the global Open Border Project (see the link below) have been pushing the Ukraine Project, telling US the Ukraine border is our business.

They never explain why it's our business, outside of their foaming at the mouth hate for Russia.

With the election of The Trump for the 3rd time, this is all about to end.

Thank god

HOLY SH*T.

UK Prime Minister Keir Starmer just admitted the UK has been running an “OPEN BORDERS EXPERIMENT!”

“This happened BY DESIGN not by accident, policies were reformed deliberately to liberalize immigration & turn Britain into a One Nation Experiment in Open Borders!” pic.twitter.com/UpnbTLS7BN— Jimmy Dore (@jimmy_dore) December 15, 2024


9,609 posted on 12/15/2024 5:42:01 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9607 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ETCM
Кремлевская табакерка

Kadyrov promised to find and punish those who “deliberately” let drones into Grozny

The Chechen leader was furious about another enemy drone hitting an important facility in Grozny . He suspects that the air defense “deliberately does not shoot down” the drones that fly into the city.

“This time the strike had particularly severe consequences. More than 10 people were killed, including officers. Ramzan Akhmatovich promised to find and punish those who let drones into Grozny. They are definitely doing this on purpose!” a source close to Kadyrov told us. He did not specify who exactly is “letting the strikes in” and why.

Some of our sources in the Presidential Administration and the Ministry of Defense suggested that “drones have begun flying into Grozny more often after some harsh statements and actions by Mr. Kadyrov.” We wrote that such hints have already been circulated and were connected, in particular, with the behavior of the Chechen leader in the conflict around Wildberries. Whether this is so, the interlocutors refused to answer directly. One of them briefly said: “Anything is possible.”

In this regard, we have an important question: who exactly does Kadyrov plan to “punish” for the strikes on Chechnya? How could ordinary military personnel suffer? How those who die from air strikes in the barracks of Grozny are already suffering from the ambitions of their leaders.

https://t.me/kremlin_secrets/5037

LOL!

9,610 posted on 12/15/2024 6:29:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9608 | View Replies]

To: PIF; BeauBo; blitz128; Magnum44; ansel12; ETCM; marcusmaximus; AdmSmith; gleeaikin; BroJoeK
Big story posted all over x.com. Some claim both tankers have sunk.

Russian oil tanker "Volgoneft 212" is in distress near the Kerch Strait, Russian media report.

The ship is carrying 4000 tons of mazut, a low-grade fuel oil. 13 crew members are also reportedly on board.

The tanker was allegedly broken in half by waves and is sinking rapidly. This is the second Volgoneft ship to be wrecked by waves in recent memory—this is allegedly due to poor workmanship when the ship was upgraded.

A rescue operation is ongoing. If the tanker's contents spill into the sea, it could spell ecological disaster.

https://x.com/Gerashchenko_en/status/1868231104601403476

Here's another link:

Two Russian oil tankers near the Kerch Strait, Black Sea, are in distress. One seems to sink and there is an obvious oil spill.

https://x.com/Tendar/status/1868234357867004194

Most likely, both tankers were part of ruzzia's shadow fleet and were uninsured.

9,611 posted on 12/15/2024 6:55:40 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9610 | View Replies]

To: AdmSmith
Here's a video of the attack:

The war has reached Chechnya: this morning, a Ukrainian drone hit OMON headquarters in Grozny.

https://x.com/P_Kallioniemi/status/1868201873519280206


9,612 posted on 12/15/2024 6:58:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9610 | View Replies]

To: AdmSmith
A closer shot of the drone attack on Grozny appeared in Russian Telegram channels.

It is reported that a base of the special operations unit was hit.

https://x.com/Gerashchenko_en/status/1868198465513443461


9,613 posted on 12/15/2024 7:00:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9612 | View Replies]

To: PIF
Allegedly the north korean soldiers on a WW1 style assault in the kursk region, with the same result as 108 years ago!

https://x.com/Alwin_HRV/status/1867991071537746301


9,614 posted on 12/15/2024 7:08:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9613 | View Replies]

To: FtrPilot

Much like No. 6 fuel oil (Bunker C), mazut is a refinery residual product, that is, products left over after gasoline, diesel, and other light distillates are distilled from crude oil except, unlike bunker fuel, mazut is produced from much lower grade feedstocks.

https://en.wikipedia.org/wiki/Mazut


9,615 posted on 12/15/2024 7:22:33 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9611 | View Replies]

To: BeauBo
The Security Service of Ukraine together with the Defense Forces destroyed an enemy Russian train with 40 fuel tanks in Zaporizhia region.

On December 14 Ukrainian units conducted a multi-stage special operation. The goal was to cut off the logistical routes for fuel supplies from Crimea to the territories of Zaporizhia region.

Initially, the SBU organized a sabotage operation to blow up the tracks while the train with fuel tanks was moving near the village of Oleksiyevka, Bilmatsky district. When it stopped and part of the tanks began to burn, the HIMARS MLRS entered the game. The missiles hit the locomotive and the outer cars so that the enemy could not stretch the tanks and save some of the fuel.

As a result of the special operation, a locomotive and 40 tank cars were destroyed, and an important railway line that supplied Russian troops was put out of action for a long time.

https://x.com/bayraktar_1love/status/1868245758727573753


9,616 posted on 12/15/2024 7:32:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9614 | View Replies]

To: BeauBo
Ukrainian FPV drone flying over enemy territory comes across a row of retrieved bodies of North Korean and Russian soldiers following a failed mass assault against Ukrainian defensive lines in the Kursk region of Russia.

After 70 years of no real battles, the North Korean Army gets to experience winter warfare in Russia

https://x.com/visegrad24/status/1868306427233574966

https://pbs.twimg.com/media/Ge2RAybWoAE7ETS?


9,617 posted on 12/15/2024 7:40:56 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9616 | View Replies]

To: marcusmaximus
Always sad when a pilot does not return from his mission.

S-400 is highly capable against aircraft. Flying at very low altitude shrinks the engagement zone.

Preemptive HARMs would force the S-400 to shut down prior to the missile going active.

I doubt we will ever see the "details" of the shootdown.

Hopefully, UKF will be able to takeout the S-400 site.

9,618 posted on 12/15/2024 7:52:14 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9597 | View Replies]

To: PIF
Oryol oil depot - russia

🔥🔥🔥🔥🔥

https://x.com/DakdaR22/status/1868057637243507071

In the video, it appears the oil is leaking out of the bottom of the tank and then catching fire.

The fire spreads to other tanks.


9,619 posted on 12/15/2024 8:02:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9617 | View Replies]

Wall Street Journal

Moscow fired four times as many drones and missiles this fall as it did the previous year, according to a Wall Street Journal analysis.

Russia launched more than 6,000 drones and missiles this fall, per The Wall Street Journal.

Russia is increasing its use of decoy drones against Ukraine.

Russia fired four times as many drones and missiles at Ukraine in the past three months compared to the same time a year ago, according to an analysis by The Wall Street Journal.


9,620 posted on 12/15/2024 8:06:47 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9609 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,581-9,6009,601-9,6209,621-9,640 ... 18,521-18,531 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson