Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,361-9,3809,381-9,4009,401-9,420 ... 20,141-20,154 next last
To: JonPreston
And Americans devastated by floods in North Carolina get ZERO

JUST IN: White House announces $50B loan for Ukraine

pic.twitter.com/S8OFN5xxgi— Eric Daugherty (@EricLDaugh) December 10, 2024


9,381 posted on 12/10/2024 3:56:21 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9370 | View Replies]

To: PIF
A tank from the 214th Special Battalion OPFOR cleared out buildings with Russians hiding inside in the Kurakhove direction.

https://x.com/NOELreports/status/1866437132581302296


9,382 posted on 12/10/2024 5:31:54 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9379 | View Replies]

To: BeauBo

As I understood it Russians taxes gross income not net income, if I am wrong then I apologize


9,383 posted on 12/10/2024 5:33:33 PM PST by blitz128
[ Post Reply | Private Reply | To 9377 | View Replies]

To: blitz128
💥 Russia turned into Hell: Ukraine's new Peklo cruise missiles delivered on their name as they lit up the night sky in Bryansk, destroying an oil depot on their debut flight.

Peklo means Hell in Ukrainian.

https://x.com/igorsushko/status/1866633180524253363


9,384 posted on 12/10/2024 5:42:13 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9383 | View Replies]

To: blitz128

I don’t know across the board, but they do with oil and gas producers.


9,385 posted on 12/10/2024 7:31:07 PM PST by BeauBo
[ Post Reply | Private Reply | To 9383 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, December 10, 2024

Russia intends to supply North Korea with fighter jets amid growing military partnership between the two countries. US Indo-Pacific Command (INDOPACOM) commander Admiral Samuel Paparo revealed on December 10 that Russia and North Korea struck a deal in which Russia agreed to send MiG-29 and Su-27 fighter aircraft to Pyongyang in exchange for North Korea deploying troops to Russia to support Russia’s war in Ukraine.[8] Paparo highlighted that North Korea’s receipt of these aircraft will enhance its military capabilities and that Pyongyang likely expects additional military equipment and technologies from Russia, including ballistic missile reentry vehicles, submarine technologies, and air defense systems, as part of the agreement. Paparo noted that North Korean soldiers remain in combat zones, likely in reference to Kursk Oblast, but are not yet actively fighting. South Korean network TV Chosun published an exclusive report on October 21 stating that North Korea dispatched an unspecified number of fighter pilots to Vladivostok before the deployment of ground troops to Russia in early October likely in an effort to train its pilots to fly Russian fighter jets.[9] North Korean pilots are trained on Russian Su-25 attack aircraft (which are already part of the Korean People’s Army [KPA] Air Force fleet) further indicating that a Russian delivery of fighter jets will benefit and expand North Korea’s military capabilities, especially in the air domain.[10] ISW continues to assess that military cooperation between Russia and North Korea has particularly intensified since the two countries signed their Treaty on Comprehensive Strategic Partnership in June 2024, and especially since it entered into force on December 4.[11]
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-10-2024


9,386 posted on 12/11/2024 2:55:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9346 | View Replies]


9,387 posted on 12/11/2024 2:58:29 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9316 | View Replies]


9,388 posted on 12/11/2024 3:39:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9347 | View Replies]

To: BeauBo; PIF; FtrPilot
Moscow is running out of money

Кремлевская табакерка
The budget is not elastic. They will look for money everywhere. And this is only the beginning! The news that part of the fines for violating traffic rules is planned to be sent from the regions to the federal budget went almost unnoticed. It would seem that 25% is not that much. But in fact, this is an extremely serious story.

First, if you remember, the regions were given a race to attract men to the SVO [war in Ukraine]. With additional payments, which in some places exceeded several million for one contract. Now part of the money from the regions will be taken for federal needs. And so that the regions do not worry too much, the fines for violating traffic rules themselves will be increased by 1.5 times. The discount for prompt payment will be reduced. In general, the regions will remain with about the same money, but the federal budget revenues will increase.

Sources say that this is far from the last step that the authorities are preparing to increase the revenue side of the budget. “ New taxes , excise duties - everything will be there. We should expect a tax increase for the rich and a little less for the poor - funds are needed for the war,” a source in the government's economic bloc told us.

https://t.me/kremlin_secrets/5020

9,389 posted on 12/11/2024 3:59:32 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9385 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Putin’s Nightmare: Civilians Uprise, Offensive Fails, Governor Kicked Out ]


Today [ Dec 10, 9 pm ], there are a lot of interesting updates from the Kursk direction.

Here, the Russian offensive has faltered disastrously, leaving their forces struggling to hold ground as Ukrainian troops continue to gain momentum. Amid growing unrest, civilians in Kursk - caught in the crossfire - have intensified their protests, forcing Putin to fire the governor of Kursk in a dramatic response to these mounting failures.

The 3rd wave of the Russian counter-offensive in Kursk aimed to execute a pincer maneuver towards Malaya Lokhnya from two axes, intending to cut off a large number of Ukrainian soldiers in the northern part of the Kursk salient.

Russian forces sought to replicate their initial success from Korenevo by using mechanized assault units to rapidly penetrate into the Ukrainian rear. However, after nearly two months of daily assaults, their offensive failed to make any further significant territorial gains, and the efforts to capture Malaya Lokhnya ultimately collapsed.

Russian tactics involved deploying large mechanized assault groups that used the full speed of their vehicles along paved roads to bypass Ukrainian frontlines and quickly reach rear positions, dismounting to attack from unexpected angles.

These tactics had previously succeeded, allowing Russia to capture Zeleni Shlyakh and collapse Ukrainian defenses to its north. However, the repetitive nature of these counterattacks, since August, allowed Ukrainian forces to analyze and predict Russian strategies. This insight enabled them to adapt and prepare for the 3rd wave of counterattacks, significantly reducing their effectiveness.

Ukrainian forces correctly anticipated Malaya Lokhnya as the next target of the Russian offensive, allowing them to fortify the area and heavily mine the roads, which effectively eliminated countless Russian mechanized assaults over the past months.

Unlike the terrain near Korenevo, the routes to Malaya Lokhnya are flanked by elevated positions near Novoivanivka and Pogrebki, giving Ukrainians a crucial advantage in detecting and targeting Russian units with artillery. Drones provided continuous surveillance for rapid responses. This layered defense allowed Ukrainian tanks to intercept Russian columns, neutralizing mechanized units and halting the offensive.

Repeated waves of Russian attacks yielded only minor territorial gains near Novoivanivka, where small groups of Russian soldiers briefly held positions. However, these gains came at a steep cost, as heavy losses in troops and equipment severely depleted Russian offensive capabilities, creating opportunities for Ukrainian counterattacks.

Combat footage from the area shows a Ukrainian Bradley infantry fighting vehicle using its 25mm autocannon to suppress Russian positions. This suppression allowed Ukrainian troops to dismount and effectively overrun the Russian-held positions, ultimately reclaiming control of Novoivanivka.

As the Russian offensive slowed and devolved into slow, grinding battles that left most villages in the area destroyed, widespread social discontent increased amongst Russian civilians, particularly refugees from the conflict zones. The fighting displaced nearly 150,000 people, or almost 10% of the Kursk region’s population.

Many of these refugees expressed frustration with the Russian civilian and military administration’s failure to provide adequate housing and support while they were displaced, as their homes and belongings were left behind and where actively being destroyed by the ongoing battle.

Putin recognized that growing social discontent among the refugee population could spread. if the situation, particularly regarding the offensive and housing issues, wasn’t seen as stabilizing. To address this, he dismissed Kursk Governor Alexei Smirnov, blaming him for Russia’s failure to respond effectively to the Ukrainian incursion and its aftermath, replacing him with Alexander Khinstein.

The dismissal was delayed for months as the Russian government downplayed the impact of the Ukrainian offensive. However, the continued failure to eliminate the Kursk salient, eventually forced the political leadership to acknowledge the severity of the situation and remove him from office.

Overall, as the Russians failed to adapt their tactics from their initial assaults, Ukrainians were able to organize a strong defense and effectively counter the Russian approach. This led to the Russian offensive stalling and falling short of its objectives, forcing the Russian government to take more drastic measures, including replacing the governor of Kursk.

Smirnov’s dismissal is intended as a short-term solution to alleviate social discontent. However, the underlying issues caused by the Ukrainian incursion in Kursk, along with ongoing civilian struggles, persist. Continued Russian failure in the Kursk region is likely to exacerbate these problems, further escalating social unrest.


9,390 posted on 12/11/2024 4:51:29 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9385 | View Replies]

To: AdmSmith

Russia Giving North Korea MiG-29s And SU-27s Isn’t That Straightforward
A U.S. admiral says that the fighters will be given to North Korea in exchange for sending troops and ammo to help Russia in Ukraine.
https://www.twz.com/air/russia-giving-north-korea-mig-29s-and-su-27s-isnt-that-straightforward


9,391 posted on 12/11/2024 4:54:12 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9386 | View Replies]

To: All
"And Americans devastated by floods in North Carolina get ZERO"

The best numbers I can find say that total relief and restorations from Hurricanes Helene and Milton will reach $50 billion each = $100 billion in total.
This puts the two combined at #5 in the all-time greatest natural US disasters, as measured by restoration costs, in today's dollar equivalents:

  1. $250 billion Katrina (New Orleans) 2005 -- 11 years to fully recover
  2. $170 billion Harvey (Houston) 2017 -- 7+ years to recover
  3. $125 billion Maria (Puerto Rico) 2017 -- 7+ years not yet recovered
  4. $110 billion Sandy (East Coast, esp. New York) 2012 -- 7 years to recover
  5. $100 billion Helene and Milton (Southeast) 2024 -- estimate 5-10 years for full recovery
  6. $ 75 billion Ida 2021 (Florida) -- expected 7 years to recover
  7. $ 32 billion CA Wildfires (California) 2018 -- expected 7+ years to recover
The total of funds spent or allocated to Helene and Milton, so far, are roughly:
  1. $7 billion -- Insurance company payouts
  2. $3 billion -- Federal disaster relief funds
  3. $1 billion -- State disaster cleanup & repair funds
  4. $1 billion -- NGOs such as Red Cross relief efforts
  5. $12 billion -- total spent so far.
Major disasters are never recovered from overnight, they always take many years to fully restore.

A president actively pushing Congress and states to approve and complete their restoration projects could well reduce years off the process.

9,392 posted on 12/11/2024 4:55:38 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9381 | View Replies]

To: FtrPilot

Israel Lays Waste To Syria’s Missile Boats (Updated)
Israel targeted Syrian Navy vessels as part of hundreds of strikes aimed at preventing former Assad regime assets falling into rebel hands
https://www.twz.com/news-features/israel-lays-waste-to-syrias-missile-boats


Syria’s Suddenly Permissive Airspace Prompts Flurry Of Foreign Airstrikes (Updated)
The fall of Assad has resulted in open season on legacy Syrian military capabilities and ISIS from the air.
https://www.twz.com/news-features/syrias-suddenly-permissible-airspace-prompt-flurry-of-foreign-airstrikes


Fate Of Russia’s Prized Syria Bases: What We Know
Moscow’s naval port in Tartus and airbase in Latakia are in very precarious states after the fall of the Assad regime.
https://www.twz.com/news-features/fate-of-russias-prized-syria-bases-what-we-know


Ukraine’s Drone Boats Are Now Shooting Machine Guns At Russian Helicopters, Boats
Gun-armed Sea Baby uncrewed vessels have emerged amid growing Russian efforts to stymie Ukraine’s kamikaze drone boat attacks.
https://www.twz.com/sea/ukraines-drone-boats-are-now-shooting-machine-guns-at-enemy-helicopters-boats


Our Best Look At Russia’s Shadowy Zircon Hypersonic Missile
The Russian Navy launched the Zircon cruise missile as part of a large-scale live-fire exercise in the Mediterranean.
https://www.twz.com/sea/our-best-look-at-russias-shadowy-zircon-hypersonic-missile


The Story Of Russia’s Secretive RS-26 Intermediate Range Ballistic Missile
The Oreshnik missile that Russia used today in Ukraine has roots in the supposedly defunct RS-26 Rubezh ballistic missile program.
https://www.twz.com/land/the-story-of-russias-secretive-rs-26-intermediate-range-ballistic-missile


9,393 posted on 12/11/2024 5:00:11 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9384 | View Replies]

To: PIF
Last night in Taganrog, Russia, the 325 Aviation Repair Plant was attacked by missiles.

While the extent of the damage is difficult to assess, official authorities reported "14 burned vehicles" in the parking lot.

Meanwhile, local residents complained that shelters were locked during the alert, sirens sounded only after the strikes, and SMS notifications arrived 40 minutes after the explosions.

https://x.com/wartranslated/status/1866790560146534521

The Ukrainian missiles weren't detected by ruzzian radars.

9,394 posted on 12/11/2024 5:38:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9384 | View Replies]

To: BroJoeK
The best numbers I can find say that total relief and restorations from Hurricanes Helene and Milton will reach $50 billion each = $100 billion in total.

And that would explain why many Americans in the affected areas are still living in tents, sans electricity and necessary food.


9,395 posted on 12/11/2024 5:48:23 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9392 | View Replies]

To: PIF; AdmSmith
The norks get ruzzian gen 3+ junk aircraft while South Korea is designing & developing a gen 5 aircraft.


9,396 posted on 12/11/2024 5:49:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9391 | View Replies]

To: PIF
🔥The 🇺🇦 Ukrainian drone operator «AEROBOMBER» continues to destroy Russian invaders with accurate drone-dropped munitions.

https://x.com/GloOouD/status/1866779258531492276

The thermal imaging camera in the drone makes it impossible for the orcs to hide.

9,397 posted on 12/11/2024 5:54:40 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9396 | View Replies]

To: PIF
The warriors from the 36th Marine Brigade repelled a russian attack in the Kursk region and destroyed 4 BMD-2 IFVs.

https://x.com/DefenceU/status/1866830544337768918

Kursk.


9,398 posted on 12/11/2024 6:01:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9397 | View Replies]

To: PIF
Russia, the great superpower, is so advanced it’s now sending old Ladas draped in fishnets to the frontlines—because even the families of their fallen soldiers said, ‘Thanks, but no thanks.’

https://x.com/saintjavelin/status/1866839437122081083


9,399 posted on 12/11/2024 6:10:02 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9398 | View Replies]

To: PIF
⚡️In Glushkovo, Kursk region, 🇺🇦 Ukrainian military discovered and destroyed at night a 🇷🇺 Russian Armed Forces ammunition depot that the Russians had placed in a private house.

https://x.com/front_ukrainian/status/1866835666195374125


9,400 posted on 12/11/2024 6:10:06 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9398 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,361-9,3809,381-9,4009,401-9,420 ... 20,141-20,154 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson