Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,181-9,2009,201-9,2209,221-9,240 ... 20,181-20,187 next last

🚨BREAKING: President Trump plans to "take care of" every single homeless veteran and take them off the streets using money meant for Ukraine. pic.twitter.com/BzcK6SsAmW— Bo Loudon (@BoLoudon) December 6, 2024


9,201 posted on 12/07/2024 6:10:38 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9200 | View Replies]

To: gleeaikin
Does he mean no women in military

Lt. Col. Bree Fram, Pentagon official: “Share your pronouns in your email, especially if you are someone who thinks you don't need them.” This will soon be erased as an issue.
pic.twitter.com/In4tRsfAI2— 🇺🇸Lionel🇺🇸 (@LionelMedia) December 7, 2024


9,202 posted on 12/07/2024 6:14:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9122 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Kim Jong-Un in Shock! Ukrainian Jets Obliterate North Korean Deployment! ]


Today [ Dec 06, 8 pm ], there are a lot of updates from the Kursk direction.

Here, Ukraine’s precision airstrikes have begun targeting a surprising and covert element in Russia’s war effort, namely North Korean forces in training. The exposed vulnerabilities of these concentrated units, undergoing a last-minute change of plans in their integration with Russian brigades, are creating critical opportunities for disruption.

Recent intelligence has revealed a secret Russian plan to deploy North Korean troops in the region, but instead of forming standalone North Korean units adhering to their own military tactics and standards, Russia opted to integrate these troops into existing Marine brigades.

This approach aimed to camouflage their presence while leveraging Russian command structures, aligning North Korean forces with Russian operational needs.

A key element of this plan was the formation of so-called Special Buryat Battalions. Officially labeled as volunteers, this designation exploited the physical resemblance between Buryats, an ethnic group in Russia, and Koreans, in an attempt to obscure the identity of the North Korean personnel.

These battalions were intended to blend into the Russian Marine brigades, starting with the 155th Brigade, which had begun initial training exercises with the North Korean soldiers.

However, the plan quickly unraveled as the 155th Brigade suffered catastrophic losses in Kursk, after being thrown into relentless frontal assaults again and again by the Russian commanders, effectively ceasing to function as a combat-effective unit. The brigade’s destruction disrupted the integration process, leaving North Korean troops without functioning partner units.

This forced the Russian command to adjust its strategy, as reports now indicate that Russian airborne units have been redeployed to Kursk, specifically to facilitate the integration of North Korean troops as replacements for the destroyed marines.

Elements of the 76th VDV Division, including the 104th Regiment, were redeployed from other fronts to Kursk, evidently to backfill losses and create a framework for training North Korean detachments. Joint training exercises are reportedly underway, marking the first stage of their operational integration.

Such big redeployments create movements that are easier to track which helped the Ukrainians to localize force concentrations and training bases. In the face of this development, Ukrainian commanders decided to actively target them and disrupt their deployment on the battlefield.

As part of a broader effort to prepare the battlefield for an airstrike campaign against concentrated enemy forces, the Ukrainians destroyed a radar station of an S-400 air defense system in the region.

With the skies cleared, the Ukrainian air force conducted a precise JDAM strike on a Russian deployment site located southeast of Sudzha, using a SU-27 fighter jet. Geolocated footage from a Ukrainian surveillance drone shows how 2 JDAM bombs destroy a large building used as a base by the Russians.

This was the first attack, and such moves serve two purposes: degrading Russian operational capabilities in Kursk, and disrupting the integration of North Korean troops, signaling Ukraine’s readiness to exploit the vulnerable positioning of newly arrived VDV units and North Korean troops, as they train and prepare together.

Overall, Russia’s reliance on North Korean troops highlights the severity of its manpower shortages. The attempt to conceal their deployment under the guise of a Special Buryat Battalion reflects both the Kremlin’s secrecy, and its willingness to adapt unconventional strategies.

However, the integration of undertrained North Korean personnel into depleted Russian units is unlikely to yield significant tactical advantages, especially given the high attrition rates already suffered by Russian forces in Kursk.

The coming weeks will likely see intensified Ukrainian airstrikes on Russian and North Korean troop concentrations, aiming to preempt any offensive operations and further destabilize the Russian command structure in the region.


9,203 posted on 12/07/2024 6:18:03 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9198 | View Replies]

To: FtrPilot

If they can’t be flown they are just targets, agreed


9,204 posted on 12/07/2024 6:18:06 AM PST by blitz128
[ Post Reply | Private Reply | To 9198 | View Replies]

To: JonPreston

Please only post to me when you have substantial info + source


9,205 posted on 12/07/2024 7:26:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9200 | View Replies]

Zelensky arrests priests and bans churches

Putin bans Satanism

JUST IN: 🇷🇺 Russia outlaws Satanic Temple, deeming it "undesirable" and blasphemous of traditional religious values. pic.twitter.com/laRxluFUC7— BRICS News (@BRICSinfo) December 5, 2024


9,206 posted on 12/07/2024 7:37:28 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9205 | View Replies]

To: PIF; All
Once again, amazing information in this report...Thanks for posting & thanks for the ping!

Some comments:

Recent intelligence has revealed a secret Russian plan

ruzzian COMSEC is nonexistent.

...Overall, Russia’s reliance on North Korean troops highlights the severity of its manpower shortages...

We have seen from previous reports that the norks are "starving". Obviously, ruzzia is not going to waste good food on norks that are going to die in a meat wave.

... the Ukrainians destroyed a radar station of an S-400 air defense system in the region...

Destroyed by ATACMs. Most likely located by UKF ISR drones.

... With the skies cleared, the Ukrainian air force conducted a precise JDAM strike...

JDAMs & SDBs are cost effective, especially when compared to ATACMs.

The coming weeks will likely see intensified Ukrainian airstrikes on Russian and North Korean troop concentrations, aiming to preempt any offensive operations and further destabilize the Russian command structure in the region.

Hit them hard before they enter the fight.

9,207 posted on 12/07/2024 7:39:44 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9203 | View Replies]

To: PIF; FtrPilot
“The Black Colonel” Viktor Alksnis:

I did not comment on what happened in Syria because I expressed my attitude to the Syrian adventure back in 2015-2016. And I warned about the inevitability of what is happening there now. I then pointed out that attempts to interfere in the internal conflict were caused, first of all, by the desire at that time to distract the attention of the Russian public from the situation in Donbass and the desire to win an easy victory in that war in Syria. And it is not for nothing that all federal TV channels pompously showed us the Victory Parade in Khmeimim three times and repeatedly told us with fanfare about the complete defeat of the militants. The war there seemed to our leaders an easy walk through the Syrian deserts. That is why our ground forces were used there on a limited scale, and the main striking power was assigned to aviation. Since the militants at that time had only a limited number of portable anti-aircraft missile systems with an altitude reach of up to five kilometers, our aircraft flew at altitudes above these five kilometers and could strike them with impunity.

But today the situation has changed radically. During the militants’ triumphant offensive and the flight of the Syrian army, among other things, they managed to capture anti-aircraft systems of the Syrian and Russian armies. Including the famous Russian anti-aircraft missile and gun systems “Pantsiri” with an altitude reach of fifteen kilometers. And during the offensive, the militants will obviously take control of significant territories dividing the north and south of Syria in the coming days, over which the air routes of our military transport aviation ran, and combat aircraft were also ferried from Russia over the Caspian Sea over the territory of Iran and Iraq to Syria.

But it looks like this easy ride is now ending. How this air route will be used is unknown. Mmilitary transport aircraft delivered ammunition, weapons and spare parts to Khmeimim, and combat aircraft were replaced through it. I doubt that Turkey will allow such flights over its territory. And there are no other flight routes to Syria from Russia. So the main base of the Russian army in Khmeimim may end up in an air blockade and its fate will be sealed.

As for delivery by sea, in connection with the SVO [war in Ukraine], Turkey has blocked the Bosphorus and Dardanelles and is unlikely to allow ships of the auxiliary fleet of the Russian Navy with military cargo to and from them. Moreover, these ships may end up in the Black Sea under attack from Ukrainian unmanned boats and anti-ship missiles. The only route left is from St. Petersburg or Kaliningrad around all of Europe from the Baltic Sea to the Mediterranean Sea to the Syrian port of Tartus. But it is not for nothing that there is a saying: “A calf is worth a kopek overseas, but a ruble is for transportation!”

And what if the situation worsens and the question of evacuating our servicemen from the Khmeimim airbase arises? How will we do this? Only by sea! But these are personnel. And what to do with the aircraft, spare parts, ammunition and equipment? We will shamefully destroy, blow up and burn them in front of the whole world. So the flight of the Syrian army promises trouble not only for Bashar al-Assad and his entourage, but also creates big problems for the Russian group in Syria

https://t.me/blackcolonel2020/1662
.

9,208 posted on 12/07/2024 7:41:06 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9184 | View Replies]

To: All
The next step in the development of unmanned systems. Unmanned boat + FPV drones.

It looks like the boat has 4 slots for FPV drones, each of which contains 2 FPVs one on top of the other. Thus, 1 boat can carry 8 FPVs.

https://x.com/bayraktar_1love/status/1865319815927275978

Additional information on the attack at the link above.

9,209 posted on 12/07/2024 7:47:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9207 | View Replies]

To: AdmSmith

I will post for the usual, all is going according to plan. This is nothing but lies and propaganda 😎


9,210 posted on 12/07/2024 8:12:09 AM PST by blitz128
[ Post Reply | Private Reply | To 9208 | View Replies]

To: AdmSmith; All
Amazing information...recommended reading for all.

Clearly shows how desperate the situation in Syria is for ruzzia.

Thanks for posting!

9,211 posted on 12/07/2024 8:13:41 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9208 | View Replies]

To: FtrPilot
We have seen from previous reports that the norks are “starving”.

+ many of them are sick all the time.

9,212 posted on 12/07/2024 8:31:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9207 | View Replies]

To: AdmSmith

+ many of them are sick all the time.


There are many serious cases of metal flu, which is usually fatal.


9,213 posted on 12/07/2024 9:23:10 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9212 | View Replies]

To: PIF

Lead poisoning is often fatal 😎


9,214 posted on 12/07/2024 9:27:08 AM PST by blitz128
[ Post Reply | Private Reply | To 9213 | View Replies]

To: AdmSmith

So, you must want him to never post.


9,215 posted on 12/07/2024 10:46:39 AM PST by Mr. Lucky
[ Post Reply | Private Reply | To 9205 | View Replies]

To: Mr. Lucky

So, you must want him to never post.


That would be great! He’s a pest with all his non-information and pro-Russian, anti-freedom, Putin-loving propaganda.


9,216 posted on 12/07/2024 11:05:16 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9215 | View Replies]

To: PIF
"Two days ago, 14 people went in – none survived.

Then another 7 – again, none survived.

This is not a war" – two Russian "liberators" fled their positions as soon as things got heated, inexplicably refusing to go on the assault without weapons.

https://x.com/wartranslated/status/1865388860470935642

Without weapons?

9,217 posted on 12/07/2024 11:15:41 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9209 | View Replies]

To: PIF
🔞 A Ukrainian drone makes a precise strike on a Russian Scooby Doo van full of occupiers. One of them was alive, bleeding, trying to find salvation in another UAZ. But he didn't survive here either - a second strike by a Ukrainian drone finished the job.

A Russian public page posted this video with the following comment: "We are showing it to once again tell how important it is for every vehicle of our soldiers to have electronic warfare. This one didn't. That's why it became an excellent target for our enemies. The soldier survived, but will remain disabled. But more often than not, the outcome is even worse."

https://x.com/albafella1/status/1865371326061715878


9,218 posted on 12/07/2024 11:22:13 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9217 | View Replies]

To: PIF
🔞 Russian occupiers unsuccessfully try to shoot down drones with their machine guns, pretend to be dead and think that they can simply throw away an FPV drone that did not detonate immediately.

Work of the 63rd Mechanized Brigade.

https://x.com/albafella1/status/1865144916134817998


9,219 posted on 12/07/2024 11:31:36 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9218 | View Replies]

To: FtrPilot
"Latakian People's Republic".

I was just thinking yesterday that Russia might try to negotiate with Turkey for an Alawite "People's Republic" for their Air and Naval bases. This is pretty standard practice for Russia. Of course, there is some question of just how much control Turkey has over Jolani, and how much influence Jolani has over the various groups fighting to overthrow Assad.

9,220 posted on 12/07/2024 12:19:32 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 9195 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,181-9,2009,201-9,2209,221-9,240 ... 20,181-20,187 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson