Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,961-8,9808,981-9,0009,001-9,020 ... 22,081-22,094 next last
To: AdmSmith
1,790, i.e. more than 1.24 Russians and NorKs/min

By my count, the 4 day total is over 7200.

IMHO, the following daily numbers are also impressive:

«» 28 Armored Personnel vehicles
«» 9 Tanks
«» 99 Vehicles
«» 30 Artillery
«» 83 UAVs

This clearly shows that UKF have "drone" superiority, ISR and FPV.

8,981 posted on 12/02/2024 4:16:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8976 | View Replies]

To: PIF
Today, Russian troops launched massive offensive actions in the Kharkiv region, in the area of ​​responsibility of the 42nd separate mechanized brigade of the Armed Forces of Ukraine.💥

https://x.com/UaCoins/status/1863337725841084701

The minimum confirmed enemy losses were:

13 killed;
27 wounded;
2 T-62 tanks destroyed;
2 T-62 tanks damaged;
2 BMP-3s destroyed;
1 APC damaged.

8,982 posted on 12/02/2024 5:08:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8981 | View Replies]

To: AdmSmith
The Atlantic is an extreme left-wing publication


8,983 posted on 12/02/2024 5:21:05 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8977 | View Replies]

To: FtrPilot

Two reports today: one from last evening at 8pm and the second from today at 6am

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Last Straw. Russian Soldiers Give Up ]


Today [ Dec 01, 8 pm ], there is interesting news from the Kursk direction.

Here, Russian forces are throwing everyone available, even wounded personnel, in a desperate attempt to win back the whole Kursk region from the Ukrainians by mid-January. At the same time, Ukrainian soldiers are holding their defense lines and are refusing to be pushed out by adjusting on time with all developments of the dynamic battlefield.

Facing pressure to secure favorable negotiation terms before Donald Trump’s inauguration on January 20, 2025, Vladimir Putin has ordered relentless assaults to reclaim the entire Kursk region, aiming to ensure no Russian territory remains under Ukrainian control, and to bolster his domestic and international standing ahead of anticipated peace talks.

Due to these orders, the Russian military continues to sustain heavy losses while attempting to retake territory, demonstrating a strategy that appears both desperate and poorly calculated. Despite repeated failures, Russian forces persist in their offensives, deploying waves of personnel and equipment against the cleverly structured Ukrainian defense.

The result was a predictable increase in casualties, which prompted Russian commanders to throw wounded soldiers, before they had been completely healed, back to the frontlines, due to a dire shortage of skilled personnel.

On top of that, the rapidly deteriorating weather has put the Russian offensive to a complete halt. Russian soldiers are reporting that they are losing their tanks and armored vehicles before they even get close to the frontline because they get stuck in mud.

Many of these vehicles simply cannot be evacuated, and are finished off by the Ukrainian kamikaze drones before the weather gives Russians any chance to try and evacuate their tanks. Soldiers struggle to navigate the mud, losing cohesion and becoming easy targets, further degrading Russian operational capacity in these increasingly unforgiving conditions.

One Ukrainian soldier commented that the Russians continue to bet on achieving results with the same approach of frontal attacks, even though it is hardly yielding any results. His statement is confirmed by a geolocated video from Zeleny Shlyah, released by the Ukrainian 36th Marine Brigade.

It shows a Russian mechanized assault aimed at breaking through the Ukrainian defense and advancing the stalled offensive in the region. 2 armored vehicles attempt to push forward, but are swiftly destroyed by Javelin anti-tank guided missiles.

The remaining troops, trying to secure nearby trenches, are bombarded by drones and eliminated in close combat, turning the assault into a complete disaster. Such failures make the Russians seriously concerned about the situation, realizing that no matter what Putin demands, they won’t be able to reclaim the territory in Kursk anytime soon.

The situation has become so dire that Russian soldiers have begun recording videos urging their families never to join the army, warning that doing so would mean certain death. These harsh messages, discovered by Ukrainians on the phones of fallen Russian troops, reveal the desperation of those who sent these recordings to their relatives, just before being forced again into suicidal assaults.

Overall, the culmination of several key factors has created a scenario where Russian attempts to retake the Kursk region are met with increasingly high costs and diminishing returns. Rather than adjusting their tactics to account for the harsh realities on the ground, Russian commanders appear locked into a pattern of brute-force assaults, relying on sheer numbers to compensate for a lack of strategy.

This approach not only exacerbates their losses, but also highlights the limits of their operational effectiveness in the face of adverse weather and resilient opposition. The ongoing campaign in Kursk thus stands as a grim testament to the flaws in Russia’s military strategy.


[ Offensive Crumbles! Kursk Becomes a Russian Nighmare! ]

Today [ Dec 02, 6am ],there are a lot of updates from the Kursk direction.

Here, in a desperate attempt to penetrate the Ukrainian salient from the west, the Russians have committed their entire arsenal of armored vehicles to the battle.

However, the devastating losses inflicted by Ukraine’s layered defenses seems to have exhausted their reserves of armor in Kursk to the point where they were left with no options other than to resort to pure infantry assaults on foot with even more catastrophic outcomes.

The main Russian goal here is to create a foothold on the east side of the Snagost River, capture the settlements along the bank, and collapse the Ukrainian defense to cut off supplies to Ukrainian forces to the north.

All Russian attacks to this moment have failed due to the natural barrier in the form of the river, and the strong Ukrainian positions on elevated points on the other side.

This has prompted the Russians to change their approach and throw all their efforts to break through from the north around Tolstyi Lug. If they establish a firm presence in the area, they will achieve not only their main goal, but will also be able to increase the direct attacks against Novoivanovka to the east, where they have failed miserably in the previous weeks.

The initial Russian assault involved several armored personnel carriers attempting to bypass a large local water reservoir and advance southward. However, the repeated use of this route in prior attacks on Novoivanovka had led Ukrainian forces to maintain constant surveillance of the area with drones equipped with thermal imaging.

Once the Russian vehicles were detected, Ukrainian forces swiftly engaged them with Javelin anti-tank missiles, obliterating the convoy on the spot. The surviving troops sought refuge in the tree line near the water, but were quickly neutralized by precision strikes from FPV drones.

This initial attempt by the Russians was aimed at finding out the Ukrainian fire positions and checking how quickly they would respond. It was immediately followed by several large waves of at least 6 to 10 armored vehicles each, including several types of tanks, infantry fighting vehicles, and bigger numbers of infantry.

The main Russian idea was to overwhelm the defenders and penetrate their line with brute force, prompting them to retreat further east.

Unfortunately for the Russians, the Ukrainians had anticipated such moves and extensively mined large sections of the surrounding fields. This forced the attackers to attempt a breakthrough along their former defensive positions, originally designed to protect the international border.

Geolocated footage revealed the dire consequences: some Russian vehicles became immobilized on anti-tank dragon’s teeth, making them easy targets for Ukrainian forces, while others were caught in the open and swiftly destroyed by a combination of Javelin missiles, artillery strikes, and FPV drone attacks.

Wave after wave of Russian mechanized assaults ended in flames, with soldiers of the Ukrainian 225th Assault Battalion and the 36th Marine Brigade, publishing several videos highlighting the devastating results of the two-day-long Russian operation.

The images show fields cluttered with burning remnants of Russian tanks and armored vehicles, scattered along a vast area between Tolstyi Lug, Zelenyi Shlyakh, and Nizhnii Klin, turning it into a graveyard of tanks and other armored vehicles.

One Ukrainian fighter from the 24th Assault Battalion confirmed that Russians switched to pure infantry assaults now, which indicates that the Russian units lost so much armor so quickly that they ran out of reserves in the warehouses in Kursk.

Overall, the relentless Russian attempts to break through the Ukrainian defenses around Tolstyi Lug have resulted in catastrophic losses, both in personnel and equipment.

Despite shifting tactics and exhausting resources, they have been unable to overcome the well-prepared Ukrainian positions, underscoring the ineffectiveness of their campaign in this region despite Putin’s orders and deadlines.


8,984 posted on 12/02/2024 5:22:48 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8982 | View Replies]

Where is Speedy?

Day 31


8,985 posted on 12/02/2024 5:28:21 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8983 | View Replies]

To: PIF
💥 Russia: Ukraine conducted HIMARS cluster munitions strikes on the command center of the Russian VDV 83rd Airborne Assault Brigade in Kursk region right as the troops lined up outside in formation.

At least 12 killed including 4 officers and 25 wounded.

https://x.com/igorsushko/status/1863313202932797612

Kudos to UKF target intel.

8,986 posted on 12/02/2024 5:32:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8984 | View Replies]

To: AdmSmith
⚡️Russia loses almost 46,000 troops, over $3 billion worth of military equipment in November, Defense Ministry says.

The Russian military also lost 2,030 soldiers in one day, which is the highest rate of Russian losses in a day since Feb. 24, 2022.

https://x.com/KyivIndependent/status/1863250391262965922

It is amazing how fast ruzzian junk turns to rust.


8,987 posted on 12/02/2024 5:49:44 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8986 | View Replies]


8,988 posted on 12/02/2024 5:51:13 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8987 | View Replies]

To: PIF
Overnight, 31 Russian drones entered Belarus, reports monitoring group "Hajun."

Some drones crossed the border multiple times.

Six drones were reportedly lost over Belarusian and Russian territory.

https://x.com/NOELreports/status/1863553030093742289


8,989 posted on 12/02/2024 5:54:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8988 | View Replies]

To: FtrPilot

That’s not only rust - its what fire damaged steel looks like.


8,990 posted on 12/02/2024 6:24:12 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8987 | View Replies]

To: FtrPilot

Obsession with Speedy by usuals is fascinating


8,991 posted on 12/02/2024 7:06:28 AM PST by blitz128
[ Post Reply | Private Reply | To 8986 | View Replies]

To: FtrPilot

More GDP the usuals would claim 😂


8,992 posted on 12/02/2024 7:10:06 AM PST by blitz128
[ Post Reply | Private Reply | To 8982 | View Replies]

To: blitz128
Obsession with Speedy by usuals is fascinating - blitz128


8,993 posted on 12/02/2024 7:17:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8991 | View Replies]

To: blitz128
⚡️🇺🇦 Ukraine has strike drones capable of covering up to 1,800 km, - Ukrainian Minister of Digital Transformation Fedorov said, and we will see the first applications of drone swarms in 2025

Work is also underway to create drones to destroy long-range drones, such as the “Shahed”.

This year, 1.6 million drones have been purchased, of which 1.3 million have already been delivered, including economy models.

Fedorov stressed that Ukraine is preparing tens of thousands of vehicles for the front.

https://x.com/front_ukrainian/status/1863514750723740059


8,994 posted on 12/02/2024 7:27:37 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8992 | View Replies]


8,995 posted on 12/02/2024 7:29:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8994 | View Replies]

To: blitz128

lol I post one question about speedy and the usuals have posted many, they must really miss him to spend this much time on this thread

Almost feel bad for them😂


8,996 posted on 12/02/2024 8:21:29 AM PST by blitz128
[ Post Reply | Private Reply | To 8991 | View Replies]

To: JonPreston

I read from all sources from http://www.kcna.kp/kp to http://kremlin.ru/ and when I write about something, I always include links to references. It would be good if you did too.


8,997 posted on 12/02/2024 9:03:14 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8983 | View Replies]

To: blitz128

8,998 posted on 12/02/2024 9:42:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8996 | View Replies]

To: JonPreston

🇺🇦🇩🇪 Chancellor of Germany, Scholz arrived in Ukraine this morning with a mysterious briefcase.

Russian media says it's filled with cocaine and butt plugs for Zelensky... pic.twitter.com/pfSfUT1cnZ— Spetsnaℤ 007 🇷🇺 (@Alex_Oloyede2) December 2, 2024


8,999 posted on 12/02/2024 9:47:14 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8998 | View Replies]

To: JonPreston
16% popularity


9,000 posted on 12/02/2024 9:47:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8999 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,961-8,9808,981-9,0009,001-9,020 ... 22,081-22,094 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson