Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,881-8,9008,901-8,9208,921-8,940 ... 20,041-20,047 next last
To: AdmSmith

More about Kazakh peoples: “Landscape Painted With Tea”, Milorad Pavic, 1991.

And “Dictionary of the Khazars: A Lexicon Novel in 100,000 Words, Milorad Pavic, 1989.”


8,901 posted on 11/29/2024 1:54:28 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8900 | View Replies]

A Russian Recruit Has A One-Month Life Expectancy After Signing Up For The War In Ukraine
https://www.forbes.com/sites/davidaxe/2024/11/27/a-russian-recruit-has-a-one-month-life-expectancy-after-signing-up-for-the-war-in-ukraine/


8,902 posted on 11/29/2024 3:16:59 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8900 | View Replies]

To: BeauBo

“””””After Russia’s war in Afghanistan there was a pattern of returnees turning to careers of crime.”””””

This time many of the returning damaged men are hardened prisoners released from their cells, including rapists and murderers and even a cannibal or two.

Hard timers means damaged men and psychopaths and sociopaths and already criminal men now with combat training and learning how to operate as a team and in groups, and how to best utilize and apply weaponry, use communications, plan operations and follow through, there might not only be more crime and violence in Russia for years to come from individuals, but the gangs and crime families may become tougher and smarter and more complex.

Russia also will have 10s of thousands of returning mercenaries added to this mix and many of the oligarchs have formed their own little mercenary groups within Russia.

” “A lot of major companies are creating their own private armies right now, and the brothers wanted to create their own private army on the basis of Española.”
Russian companies and state agencies have financed dozens of pseudo-mercenary groups that are now fighting in Ukraine, reported Meduza, an independent Russian- and English-language news outlet.”

“The emergence of new PMCs and paramilitary formations will inevitably result in the further paramilitarization of Russian society and the general spread of violence.”


8,903 posted on 11/29/2024 6:57:04 PM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 8875 | View Replies]

Russian Offensive Campaign Assessment, November 29, 2024

Russian Mobilization and Force Generation Efforts (Russian objective: Expand combat power without conducting general mobilization)

Russian opposition outlets Mediazona and BBC Russian Service reported that they have confirmed that at least 80,937 Russian soldiers have died in Ukraine since the start of Russia’s full-scale invasion in February 2022.[107] Mediazona and BBC Russian Service reported on November 29 that over half of the soldiers who they confirmed to have died in Ukraine were not in the Russian military at the start of the full scale invasion in February 2022; that volunteer servicemembers usually die within two to four weeks of arriving at the frontline; that volunteers comprise 22 percent of total Russian losses; and that convict recruits comprise 18 percent of total losses.

The Russian MoD is expanding the role of the Kremlin-controlled Russian Orthodox Church Moscow Patriarchate (ROC MP) in the military, likely as part of ongoing efforts to enforce pro-Kremlin ideological narratives among Russian military personnel.[108] The Russian MoD’s Main Military Political Directorate Deputy Chief Oleg Veselkov stated that the Russian military created a role that would allow assistants to military district commanders to work with ROC MP representatives. Veselkov described the religious assistant as “the commander’s confessor, who is always with him — at the front, at the command post, among the troops” and noted that ROC MP Head Patriarch Kirill has selected and appointed these religious assistants.[109] Veselkov noted that priests in the Russian military will now work with soldiers at an individual level on the frontline.

The Kremlin is reportedly incorporating its “Time of Heroes” program that aims to place veterans of the Russian full-scale invasion of Ukraine in positions in local, regional, and federal governments into its effort to militarize occupied Ukraine and illegally integrate occupied Ukrainian territory into Russia. Former Donetsk People’s Republic (DNR) First Deputy Information Minister Danil Bezsonov claimed that the Russian presidential administration and the ruling United Russia party are attempting to create more opportunities for veterans to participate in the Russian State Duma elections in 2026 to represent occupied Ukraine.[110] Bezsonov also claimed that the Russian presidential administration and United Russia assess that the “Time of Heroes” program has been successful and that Russian authorities plan to introduce participation in the program into each occupied region of Ukraine. The Kremlin may also intend to incentivize Russian military service in occupied Ukraine through the prospects of career opportunities.

The Russian military reportedly continues to forcibly impress civilians into the military. A Russian insider source claimed on November 28 that Russian military enlistment offices are working with Russian law enforcement, public associations, and Cossack groups to conduct quarterly illegal raids to find “volunteers” to serve on the frontline across unspecified regions and cities in Russia. The insider source claimed that these raids target young adults and migrants and will target people who are inebriated during the New Year holiday.[111]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-29-2024


8,904 posted on 11/30/2024 2:32:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8830 | View Replies]

It continues 1,740, i.e. more than 1.20 Russians and NorKs/min
8,905 posted on 11/30/2024 2:37:31 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8864 | View Replies]

To: AdmSmith

A Russian Recruit Has A One-Month Life Expectancy

I think that’s down to 7-20 days life expectancy now.


8,906 posted on 11/30/2024 4:42:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8902 | View Replies]

To: AdmSmith

There seems to be a possibility that any Norks killed were the result of a LR missile strikes, as they seem to be a liability at the front - not knowing how to throw a grenade and all.


8,907 posted on 11/30/2024 4:46:10 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8905 | View Replies]

To: BeauBo

This could be the direction which accounted for the recent heavy Russian losses.

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Wrong Map. Entire Column Wiped Out by Ukrainian Ambush ]


Today [ Nov 30 ], there are a lot of important updates from the Chasiv Yar direction.

Here, the battle for main Ukrainian stronghold took a dramatic turn as Russian forces intensified their efforts to establish a foothold on the left bank of the canal. What Russians initially thought was a successful breakthrough quickly unraveled into chaos, with devastating consequences for their troops and mechanized assault groups.

After a three-month campaign, Russian forces established a narrow bridgehead on the west bank of the canal in Chasiv Yar near Kalynivka. Once they gained control of most of Kalynivka and secured the northern flank, they moved into the second phase of their battle plan.

Kalynivka offered several tactical advantages for the Russian forces, including the canal crossing, local houses, and nearby forest. The canal crossing allowed them to deploy troops across, with at least some change of survival, avoiding completely suicidal cross-canal attacks within Chasiv Yar. The surviving infantry could also conceal in the houses and forest, gathering reserves for planned wave assaults.

After hundreds of attacks over the months, Russian stormtroopers used forest positions to launch assaults from the north toward Chasiv Yar’s Zhovtnevyi district. Artillery and air support tried to soften Ukrainian positions, reducing much of the residential area to ruins.

However, the stormtroopers still had to cross a 500-meter open field on foot, leaving them exposed to Ukrainian drones and artillery. These conditions led to highly attritional assaults, with many Russian waves suffering heavy casualties, often with no survivors.

Ukrainian forces in the area recognized this as the logical Russian attack route, being the only way to strike Zhovtnevyi district. They focused artillery fire and drone surveillance on the fields, while also scattering land mines.

This created a deadly kill zone, where large groups of Russian stormtroopers were wiped out during their assaults, drastically reducing their survivability and allowing only a few to reach the ruined district of Chasiv Yar.

Russian command launched wave after wave of assaults across the open field, allowing survivors to regroup on the outskirts of the town for more organized attacks. These attack groups targeted the residential district, made up of one-story houses, and were supported by Russian positions in the high-rise buildings of the Kanal district, which provided fire control and a clear view of Ukrainian positions.

The combination of high-rise fire control, relentless wave attacks, and airstrikes forced Ukrainian fighters in Zhovtnevyi district to pull back slightly to the west, as their positions became increasingly risky and offered little tactical advantage.

Despite establishing a presence near the canal, Russian forces faced severe logistical challenges. Airstrikes had destroyed much of the local infrastructure, forcing troops to rely on basements that offered no suitable firing positions. The destruction of the only road bridge linking Russian forces across the canal, further compounded the issue, preventing supply deliveries.

Any logistical support had to cross the same kill zone controlled by Ukrainian artillery and drones. Additionally, Ukrainian drones maintained fire control over the Russian positions, eliminating any forces attempting to move in or out of the basements, while artillery further suppressed them.

Russian commanders overlooked the logistical issues, mistakenly assuming that Russian forces in the basements of the demolished residential district had secured the area and that mechanized assaults could proceed toward the town center. A column of 7 BMD-4s, carrying 50 soldiers from specialized airborne units, was deployed along the railway embankment and nearby bridge north of the captured Zhovtnevyi district.

However, they quickly found themselves in the Ukrainian kill zone, where Ukrainian strikes destroyed the entire column. Landmines placed by Ukrainians obliterated many vehicles, causing panic and forcing others to halt, making them even easier targets. Ukrainian FPV drones then attacked the advancing remnants, supported by artillery, and the entire Russian column was wiped out, before reaching the bridgehead they believed was secure.

Overall, the developments around Chasiv Yar highlight the Russian inability to consolidate control and supply the captured areas adequately, further worsened by the predictability of their attacks, which the Ukrainians managed to exploit. The predictability of their attacks enabled the Ukrainians to estimate their planned routes of attack, destroying their mechanized columns, which led to no territorial gains for the Russians in this sector.

Ukrainian forces do not let their guards down even in less active directions like Chasiv Yar, successfully displayed their adaptability, and successful coordination and organization of defenses in form of tactical kill zones


8,908 posted on 11/30/2024 5:07:19 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8899 | View Replies]

To: PIF
⚡️🇺🇦 Ukrainian F-16 fighters destroyed seven 🇷🇺 Russian cruise missiles aimed at civilian targets a few nights ago. They were effective, Ukrainian President Zelensky said.

https://x.com/front_ukrainian/status/1862767235976102114

During the attack, 76 of 85 cruise missiles were shot down.

I would like to know:

~How many F-16s flew that night.
~Aim-120 kills
~Aim-9 kills
~20mm kills

Obviously, the surface-to-air systems also did a great job.

8,909 posted on 11/30/2024 5:58:54 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8901 | View Replies]

To: PIF
Excellent information, thanks for posting.

It's clear that the commanders in the field have their "marching" orders... Capture as much land as possible.

FTA: Any logistical support had to cross the same kill zone controlled by Ukrainian artillery and drones. Additionally, Ukrainian drones maintained fire control over the Russian positions, eliminating any forces attempting to move in or out of the basements, while artillery further suppressed them.

Drones are maintaining fire control! Awesome.

8,910 posted on 11/30/2024 6:08:33 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8908 | View Replies]

To: BeauBo
The “Atlas” oil depot in the Rostov region that was attacked by Ukrainian drones two days ago was still burning until late yesterday.

This morning they reportedly managed to extinguish the fires.

https://x.com/NOELreports/status/1862757600032354761


8,911 posted on 11/30/2024 6:38:36 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8910 | View Replies]

To: PIF
⚡️Intelligence officers of the Main Intelligence Directorate of the Ministry of Defense of 🇺🇦 Ukraine hit another three 🇷🇺 Russian radars in the temporarily occupied Crimea at night

✔️ Hit:

Radar 39N6 "Kasta-2E2" — 1 unit
Radar 48Ya6-K1 "Podlyot" — 2 units

https://x.com/front_ukrainian/status/1862768678355259834


8,912 posted on 11/30/2024 6:48:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8911 | View Replies]

To: FtrPilot

Nice Danish F-16.


8,913 posted on 11/30/2024 6:50:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8909 | View Replies]

To: FtrPilot
At a meeting with North Korean leader Kim Jong-un in Pyongyang, Russian Defense Minister Andrei Belousov conveyed to him an invitation to send a unit of the country's armed forces to the parade in Moscow in honor of the 80th anniversary of Victory. [09MAY] As Belousov stated, Moscow “expects a positive decision” (quoted by TASS ).

The Korean Central News Agency writes that the DPRK Minister of Defense No Gwang Chol, at a meeting with Belousov, declared the readiness of the party, government and armed forces of the republic to “comprehensively and in the most decisive manner support the just holy war of the army and people of Russia to protect the sovereign rights and security interests of the country.”

https://www.fontanka.ru/2024/11/30/74396471/

It is a holy war now.

8,914 posted on 11/30/2024 6:58:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8912 | View Replies]

To: AdmSmith

Kremlin snuff box, 11/30/24
https://t.me/s/kremlin_secrets

Belousov complained to Kim Jong-un about the DPRK military, but asked to send more

Andrei Belousov met with Kim Jong-un in Pyongyang [ https://t.me/mod_russia/46353 ]. Among the issues of military-technical cooperation, the issue of using North Korean troops at the front was considered. In particular, in the Kursk region.

“Andrei Removich delicately told Kim Jong-un that his military was behaving incorrectly in some places. As a deeply religious person, he gave an example of desecration of an icon [ https://t.me/kremlin_secrets/4874 ]. He also spoke about the lack of discipline, they say they are leaving positions due to shelling. The minister also noted the need for better preparation and equipping fighters from the DPRK,” a source close to Belousov told us [ https://t.me/kremlin_secrets/4946 ].

However, according to the interlocutor, Belousov brought a proposal to expand the DPRK contingent in Russia. In particular, already in January-February it is proposed to use units not only in the Kursk region, but also in the Northern Military District zone. Here, as we were told in the Kremlin, the degree of foreign policy and the reaction of Western countries will be taken into account.

As a bonus, Belousov invited Kim Jong-un personally and his troops to the Victory Day Parade on May 9.


8,915 posted on 11/30/2024 8:53:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8914 | View Replies]

To: PIF

The sawtooth pattern of the ruble exchange chart shows an algorithm repeatedly injecting into the market, every time the currency hits its trigger level. No doubt it is the Russian Central Bank, rushing to catch the falling ruble, like jumping on a grenade (no one else cares).

https://www.xe.com/currencycharts/?from=USD&to=RUB&view=1D

Let them spend themselves dry, to the last drop. They are still fighting the tide of the fundamentals, buying time, at the cost of the reserves that might buffer them against the several other growing risks they face. Further and further, out on a limb.

In the end, they are unlikely to be able to hold it up. Then, the deluge.


8,916 posted on 11/30/2024 9:42:15 AM PST by BeauBo
[ Post Reply | Private Reply | To 8908 | View Replies]

To: BeauBo

They are forcibly conscripting Moscow men now.

Russian police raid Moscow clubs, detain men for military service
https://freerepublic.com/focus/f-bloggers/4281731/posts


8,917 posted on 11/30/2024 10:34:05 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8916 | View Replies]

To: blitz128; FtrPilot; PIF; JonPreston

The idea of Preston confusing a Memorandum of Conversation as a PROMISE regarding future NATO expansion shows either a total unwillingness to read this document correctly, or a lack of understanding of the English language that might be found in an otherwise well trained Russian propagandist.

The first line clearly states that the Memo was “addressing” Gorbachev on the implications of German unification and NATO’s future. Addressing means discussing, it does NOT mean promising.

Statements of fact within the Memo itself include—”If” we maintain, there “would” be no, “if” it is acceptable, we “could” have discussions, that “might” achieve this...outcome, “Maybe” there is a better way, We “don’t” have German agreement. All these words—if, would, could, might, maybe, and don’t—are words which in English are “conditional”. They do not have the power of certainty found in words like—when, will, can, undoubtedly, and do.

To suggest that anything in this Memo is an actual agreement shows a complete failure of English language education in an American school, or poor instruction or understanding of such in a foreign school, like in Russia. If not a misunderstanding of the English use of conditional statements, then saying this was a formal agreement is merely a propaganda statement of falsehood regarding a promise NOT contained in this document. THe only promise in this Memo is to further discuss the issues at hand in 1990 with the German reunification.


8,918 posted on 11/30/2024 12:39:01 PM PST by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 8816 | View Replies]

To: PIF

Apparently Russia is being forced to remove additional troops in the Ukraine fronts to bolster their efforts in Kursk.

The link below describes dissatisfaction with Nork gift of untrained Nork troops. Apparently these Nork troops have little or no training, including such skills as how to throw grenades. A Russian POW with less than 2 weeks training before deployment commented on the total lack of training shown by the Nork gift. Let us hope it is the gift that keeps on giving!

https://www.youtube.com/watch?v=KHypEm3bc-0 (appx. 5 minutes)


8,919 posted on 11/30/2024 1:21:40 PM PST by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 8842 | View Replies]

To: gleeaikin

Already posted.


8,920 posted on 11/30/2024 1:53:58 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8919 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,881-8,9008,901-8,9208,921-8,940 ... 20,041-20,047 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson