Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,821-8,8408,841-8,8608,861-8,880 ... 22,101-22,107 next last
To: BeauBo
⚔️ The Russian foothold near Dvorichna has been wiped out.

Zero left to count.

https://x.com/banderafella/status/1862052841457627623


8,841 posted on 11/28/2024 5:52:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8840 | View Replies]

To: FtrPilot

HAPPY THANKSGIVING!!!


Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Attack a Russian Air Defense Base, While Russians Are Busy Dying in The Fields ]


Today [ Nov 28 ], there are a lot of updates from the Lyman direction.

Here, in a bid to eliminate Ukraine’s foothold on the eastern bank, Russian forces launched intense assaults to push southward and gain control of key villages. However, Ukrainian forces turned the tide by exploiting Russian tactical vulnerabilities and conducting special operations deep behind enemy lines, crippling the offensive and setting the stage for a significant shift in momentum.

To eliminate the Ukrainian bridgehead on the eastern side of the river, Russian forces are advancing southward, targeting Terny as the next village in the defense line. To increase pressure on the Ukrainian soldiers there, Russian troops have intensified their assaults from 2 primary directions.

Firstly, from the north, near Novosadove, Russian infantry groups are attempting to exploit weaknesses in Ukrainian defenses to achieve a breakthrough. The terrain, with its remnants of destroyed buildings and narrow forest strips, provides hiding spots for small Russian units.

This area is defended by Ukraine’s 67th Separate Mechanized Brigade, which uses drones to monitor and intercept enemy movements, launching a relentless campaign to neutralize all enemy advancement efforts. Released images highlight the dire situation for Russian soldiers, sent into open fields, without armored support, making them vulnerable to precision strikes.

The 2nd Russian attack vector targeting Terny originates northeast of the village, where the enemy attempts to use the terrain to conceal their mechanized columns until the last moment, aiming to deploy assault groups near the village outskirts. A geolocated video released by Ukraine’s 60th Mechanized Brigade captured one such attempt.

Several Russian armored vehicles were seen speeding through a lowland path, between hill ridges to approach Terny undetected, using smoke screens for cover from drone and artillery fire. While the lead vehicle narrowly avoided disaster, the 2nd struck a mine, quickly followed by the 3rd. This highlighted the meticulous preparation of Ukrainian defenders, who had heavily mined the route in anticipation of such maneuvers.

Surviving crew members from the disabled vehicles scattered for cover, but became easy targets for Ukrainian drone operators, who immediately began dropping grenades from drones and coordinated artillery strikes on the area. To ensure the complete elimination of the assault group, FPV drones were deployed, leaving no survivors from the Russian unit.

One well-known Ukrainian soldier and military blogger commented, that despite all Russian efforts to press and infiltrate with small groups, Terny is holding thanks to the heavy losses inflicted on the enemy. He also added that another hot point in the region is the village of Torske to the south, where Russians are using similar tactics.

Soldiers of Ukraine’s 63rd Mechanized Brigade, equipped with Mavic 3T drones featuring thermal imaging, released compelling footage of a nighttime assault near Torske, supporting the earlier statement. The video shows 3 heat signatures advancing toward Ukrainian positions.

Recognizing the imminent threat, the reconnaissance team swiftly coordinated an artillery strike, eliminating 1 attacker and wounding another. The 3rd soldier managed to enter the trench, but was quickly confronted by 3 Ukrainian troops. Refusing to surrender, he was neutralized on the spot. The wounded Russian soldier was captured shortly after, providing critical intelligence on Russian plans and troop deployments.

Details like these, combined with intelligence from Ukrainian partisans in occupied territories, often enable Ukrainian special forces to carry out bold raids deep behind enemy lines. A notable example occurred near Novoaidar in the Luhansk region, roughly 60 kilometers from the frontline.

Ukrainian special operators not only destroyed a costly Arrow surface-to-air missile system by setting it ablaze, but also eliminated the entire crew responsible for its maintenance and operation. A video released after the mission showcases the smoldering wreckage of the air defense system, highlighting the precision and effectiveness of the sabotage.

Overall, the failed Russian attempts to breach Ukrainian defenses at Terny and Torske, highlight the hasted desperation of the Russians to use the last days before winter finally kicks in with full force, to reach the Zherebets River.

Simultaneously Ukrainian defenders in the region are not only defending carefully against Russian attacks, but are also taking pro-active measures, destroying valuable enemy equipment in the rear to undermine any Russian chances of success.


8,842 posted on 11/28/2024 5:56:14 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8841 | View Replies]

To: ETCM
❗️ Netherlands announces delivery of three Patriot air defense missile launchers to Ukraine

https://x.com/nexta_tv/status/1862115207016857819

ETCM...What is the maximum number of launchers in a Patriot battery?

8,843 posted on 11/28/2024 5:56:48 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8841 | View Replies]

To: FtrPilot

We will see how fast the usuals turn on Trump.

Perhaps we can list some “intelligence “ failures for Soviet Union/ Russia

Finland
German alliance
Afghanistan
Korea
1991
Chechnya
Ukraine(3 days/3 weeks/ 3 months/ 3 years


8,844 posted on 11/28/2024 5:58:56 AM PST by blitz128
[ Post Reply | Private Reply | To 8840 | View Replies]

To: PIF
⚡️Today, the Prime Ministers of Denmark, Estonia, Finland, Latvia, Norway, Poland, Sweden and Finland issued a joint statement on Ukraine.

“We will strengthen our support for Ukraine. Our countries are the largest donors of military assistance to Ukraine per capita, and our support remains unwavering. Ukraine must be able to defeat Russian aggression and secure a comprehensive, just and lasting peace. In the coming months, we will increase support, in particular to the Ukrainian defense industry, and invest in providing Ukraine with more ammunition. Ukraine’s courage and resilience are reinforced by the strong and unwavering support from our countries, of which military assistance is an important part. We call on others to do the same.”

The countries also noted their support for the Victory Plan for Ukraine and their commitment to its full integration into the European Union and the Euro-Atlantic space.

https://x.com/front_ukrainian/status/1861891609018630514

It is great to see these leaders who support Ukraine's God give right to self defense.

8,845 posted on 11/28/2024 6:12:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8843 | View Replies]

To: PIF
💥📡 GUR destroyed the Russian mobile radar 48Ya6-K1 “Podlet” in Crimea!

❗️Radar is used by the enemy to detect air targets at low and extremely low altitudes in a difficult obstacle environment.

💰 The estimated cost is $5 million.

https://x.com/Maks_NAFO_FELLA/status/1862126702647804057


8,846 posted on 11/28/2024 6:20:48 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8845 | View Replies]

To: PIF
In the Kharkiv region, ACHILLES UAV Batallion of the 92nd Assault Brigade destroyed a Russian T-72 tank, a KamAZ, Bukhanka and damaged a motorcycle, two more Bukhanka's a KamAZ and an URAL-4320 truck.

https://x.com/NOELreports/status/1862134067421970819


8,847 posted on 11/28/2024 6:31:10 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8846 | View Replies]

To: blitz128
The Trump Strategy

Step 1: Trump threatens massive 25% tariffs to destroy their economy

Step 2: Pres of Mexico threatens retaliation tariffs

Step 3: Pres of Mexico realizes 30% of her economy is exports to USA and only 2% of ours is exports to Mexico. She caves within 2 days

https://x.com/WallStreetMav/status/1861985583536480475

blitz128: "We will see how fast the usuals turn on Trump."

President Trump is a negotiator.

He states his position clearly and with force.

Putin will get the same treatment as the president of Mexico.

Putin won't know what hit him.

8,848 posted on 11/28/2024 6:48:19 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8844 | View Replies]

To: FtrPilot
will Putin have to deNazify NATO after the Ukraine?


8,849 posted on 11/28/2024 9:07:01 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8848 | View Replies]

To: NeoCons
WTF?


8,850 posted on 11/28/2024 9:09:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8849 | View Replies]

To: JonPreston
Can they actually beat The Putin?<>Thoughts please


8,851 posted on 11/28/2024 9:19:29 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8850 | View Replies]

To: FtrPilot

On November 28, the Russian President stated that decision-making centers in Kiev could become a target for the Oreshnik missile. He reported that the Defense Ministry and the General Staff are currently selecting such targets for destruction on Ukrainian territory. Putin specified that these could be military facilities, defense and industrial enterprises, or decision-making centers in Kiev.

https://www.vedomosti.ru/politics/news/2024/11/28/1077919-putin-otvetil-na-vopros

When Putler says such things, the West becomes more determined to support Ukraine.


8,852 posted on 11/28/2024 9:30:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8847 | View Replies]

To: AdmSmith
When Putler says such things, the West becomes more determined to support Ukraine.

True.

Hopefully, there is a NATO country willing to ship some Patriot PAC-3 missiles to Ukraine.

Also, every EU country will line up to buy THAAD.

8,853 posted on 11/28/2024 10:22:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8852 | View Replies]

To: PIF
commander of the russian 13th tank rgt was found to have over 40 million in his bank account due to extorting people to pay not to be sent to the front for meat assaults.

even the russians are shocked.. a little

https://x.com/secretsqrl123/status/1862159871283466477

Of course, 40 million would be rubles. But still, that equals $372,000.


8,854 posted on 11/28/2024 10:35:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8853 | View Replies]

To: BeauBo
❗️ Debris from a downed cruise missile during the morning attack on Ukraine!

https://x.com/Maks_NAFO_FELLA/status/1862144587973767214

The holes in the wings indicate the cruise missile was shot down by a missile with a proximity fuse.

8,855 posted on 11/28/2024 10:39:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8854 | View Replies]

To: FtrPilot

What do you think of this comment about THAAD?

Spktyr to Mariner; PIF

It’s actually worse than that. THAAD was never intended for use against MIRV. It was intended against short, medium and intermediate range ballistic missiles with a unitary warhead. The THAAD missiles are KKVs - kinetic kill vehicles, and must physically hit to kill with *no* explosive payloads. The most it can do against a MIRV scenario if the ballistic missile has already split the MIRVs off the missile bus is hit one of of the re-entry vehicles. It cannot do proximity kills, so the rest of the bunch will just sail by untouched.

Further, THAAD is specifically listed as incapable against hypersonic glide vehicles such as the newest generation of Chinese and Russian MIRVs, and the ones that can be loaded on Iskander-M launchers. Lockheed has been pressing the government to fund THAAD-ER for that, but the government has said no and zero have been built.

So, no, moving THAAD to Poland won’t do much of anything against MIRV-capable systems.


8,856 posted on 11/28/2024 11:43:47 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8853 | View Replies]

To: FtrPilot; AdmSmith; blitz128

Russian inflation continuing to accelerate.

Kyiv Independent reports (from official Russian sources):

“Russian monthly inflation in November hit a record high, rising over 1.5 times compared to October, the Moscow Times reported on Nov. 27.

According to the Federal State Statistics Service (RosStat), during the week of Nov. 19-25, the consumer price index increased by 0.36%, up 1.15% from the beginning of the month...

The Russian economy is facing a challenge in light of poor harvest, as well as Western sanctions (and war costs) that have been tightening over the past three years due to the full-scale invasion of Ukraine...

...Inflation’s biggest impact was on groceries, where prices have risen by a double-digit percentage and continue to rise, according to the RosStat.

Since the beginning of the year, the price for potatoes increased by 78.4%, cabbage — by 30.7%, and beetroot — by 27%. Butter costs 31.6% more, despite the government’s attempts to increase imports from Turkey and Iran.

Overall food inflation exceeded 10% for the first time since January 2023, the Moscow Times reported.

Meanwhile, the currency value has continued to drop compared to the U.S. dollar, the euro, and the Chinese yuan...

...Russian Central Bank has decided not to conduct foreign currency purchases from Nov. 28 until the end of 2024.

Russia’s ruble suffered a blow following the news that the U.S. had imposed sanctions on 50 Russian banks, including Gazprombank.

Until now, the U.S. had avoided targeting Gazprombank to enable European countries to continue paying for Russian gas supplies, as the bank serves as the main channel for energy-related payments, the Financial Times reported.

With this channel closed, international payments for Russian oil and gas will be harder, drying up a part of the Kremlin’s foreign currency revenue.

The ruble is expected to weaken further with the beginning of the winter holiday season, as companies have to import more goods from abroad to satisfy increased consumer demand.”


8,857 posted on 11/28/2024 12:07:49 PM PST by BeauBo
[ Post Reply | Private Reply | To 8855 | View Replies]

To: BeauBo; FtrPilot; blitz128; PIF
Кремлевская табакерка

Wants to “drag Putin and all of Russia to the grave.” Patriarch Kirill angered influential people with words about “Oreshnik” and the end of the world.

Patriarch Kirill made a number of loud statements - he said that Christians are not afraid of the end of the world (in the context of talk of a nuclear war) and praised the “ Oreshnik “ missile. A number of our influential sources are unhappy and even shocked by these words.

“With all due respect, Patriarch Kirill made harmful statements. Many understood him like this: a nuclear war is coming soon, the end of the world will come, but there is no need to be afraid of it. What is this? On the contrary, many have become afraid. The head of the Church is dragging Russia to the grave. Why do this?” - the interlocutor in the Ministry of Defense was indignant.

According to a source in the Kremlin, the head of the Russian Orthodox Church “wants to drag to the grave” not only the country, but also Vladimir Putin personally. “It is no secret that the patriarch is ill and dying. It is also no secret that there are internal enemies whom Vladimir Vladimirovich scared with “Oreshnik” (these people have not yet been identified, but they definitely exist, everyone knows). It turns out that the deeply respected Kirill gave these creatures the command «Фас» [a command in dog training that calls for an attack]. And they can decide: we don't want a nuclear war, let's kill Vladimir Vladimirovich. I am sure that the FSO and the FSB will not allow this. But why create such a situation? “ he was indignant. “I understand Vladimir Vladimirovich, who reminded the enemies of the destructive power of “Oreshnik”. But why is the patriarch doing this? I have no idea,” the source added.

Another source close to Putin explained the situation: “Vladimir Vladimirovich made the right statement. According to intelligence, “Oreshnik” has not particularly scared either the Kiev regime or the West. Plus, we have internal problems, you see what is happening with the economy. Therefore, the president made very correct statements, showed our strength. And the patriarch, with his call for everyone to die, decided to help. It turned out very badly.”

https://t.me/kremlin_secrets/4962

Stop asking about strikes on Moscow!

There is some kind of unhealthy atmosphere now. Many people ask us – is it true that there will be strikes on Moscow in the coming days? With drones and missiles. People are afraid. Fear goes from the elite to the masses. Of course, in such cases, the authorities should talk to the people. But since no one is ready…

“Stop asking about strikes on Moscow. There is a war going on, so they are possible every day! But there are no special warnings for the coming days. Stop panicking!” – our source in the Ministry of Defense said about this. Sergei Sobyanin’s entourage categorically refused to comment on the topic. Let's leave this fact on the conscience of our sources.

We join the call of the military. Stop panicking! As if the war is in its first year…

https://t.me/kremlin_secrets/4963

Panic spreads in Moscow. Yes, terminate Putler.

8,858 posted on 11/28/2024 12:49:36 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8857 | View Replies]

To: AdmSmith
Wall Street Journal reports that the Israeli Army was shocked by how much modern Russian weaponry they have found during their ground offensive in southern Lebanon.

Hezbollah has received modern Kornet anti-tank missiles produced as recently as 3-4 years ago.

https://x.com/bloggerbloke01/status/1858815559934128453

Also don't forget Oct.7 is Putin's birthday.

8,859 posted on 11/28/2024 12:58:58 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8858 | View Replies]

To: PIF
I would agree with the first paragraph. To be effective, the THAAD would have to hit the IRBM prior to MIRV release.

WRT the second paragraph, I would agree that THAAD is incapable against hypersonic glide vehicles and hypersonic cruise missiles regardless if they have MIRV capability or not.

I would add that THAAD, like Patriot PAC-3, would have limited coverage. For example, a Patriot PAC-3 would only be effective against a ballistic missile where the ballistic missile's target is within 32NM of the Patriot launcher.

A THAAD in Poland would not provide any coverage for Ukraine.

8,860 posted on 11/28/2024 2:04:58 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8856 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,821-8,8408,841-8,8608,861-8,880 ... 22,101-22,107 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson