Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,641-8,6608,661-8,6808,681-8,700 ... 20,181-20,191 next last
To: Mr. Lucky

Howdy Mr Lucky. It sure is swell of you to drop by!!


8,661 posted on 11/22/2024 4:01:14 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8659 | View Replies]

To: AdmSmith
⚡️🇨🇦 Canada's NASAMS air defense system is already in 🇺🇦Ukraine, says Canadian Defense Minister Bill Blair

https://x.com/front_ukrainian/status/1860017275144929449


8,662 posted on 11/22/2024 4:08:55 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8658 | View Replies]

To: JonPreston

“Those who supplied weapons used against Russia are within legal bounds to be retaliated against”

And they would be within legal bounds to shoot back.

That is the problem with your BS threats Ivan, you’d get the floor wiped with yourself, if you try.


8,663 posted on 11/22/2024 6:10:02 PM PST by BeauBo
[ Post Reply | Private Reply | To 8660 | View Replies]

To: Mr. Lucky

“The Dollar to Ruble exchange rate… 104.32 this afternoon.”

It typically flatlines through the weekend, so we will probably have to wait for Monday, to see if the slide continues, or even accelerates.

But Wow! It is getting hectic, for those unfortunate enough to be holding rubles.


8,664 posted on 11/22/2024 7:51:07 PM PST by BeauBo
[ Post Reply | Private Reply | To 8655 | View Replies]

To: AdmSmith
1,420 i.e. more than 59 Russians and Norks/h.


8,665 posted on 11/23/2024 12:14:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8639 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, November 22, 2024

Russian President Vladimir Putin and Russian military leadership continue to extol the ballistic missile that Russian forces launched at Ukraine on November 21, likely in an effort to artificially inflate expectations of Russian capabilities and encourage Western and Ukrainian self-deterrence. Putin held a meeting on November 22 with Russian Ministry of Defense (MoD) leadership, Russian defense industrial base representatives, and Russian missile developers, congratulating the Russian military for conducting a “successful” test of the Oreshnik ballistic missile in response to “those who are trying to blackmail” Russia.[1] Putin emphasized that the Oreshnik missile is not a modernization of an old Soviet missile and claimed that Russian designers created it “on the basis of modern, cutting-edge developments.” Putin reiterated claims that no system exists to defend against the Oreshnik and reported that Russia is already planning to serialize its production. Commander of the Russian Strategic Missile Forces Colonel General Sergei Karakayev told Putin that the Oreshnik can strike targets across Europe and stressed that there are no analogues to the Oreshnik anywhere in the world.[2]

US and Ukrainian reporting on the November 21 ballistic missile strike, however, emphasized that the Oreshnik missile is not inherently a novel Russian capability.[3] White House and Pentagon officials confirmed that Russia launched an intermediate-range ballistic missile (IRBM) at Ukraine, and Pentagon Spokesperson Sabrina Singh stated that Russia based the IRBM on the existing Russian RS-26 Rubezh intercontinental ballistic missile (ICBM) model.[4] Singh also reiterated that Ukraine has already faced Russian attacks with missiles that have “significantly larger” warheads than the Oreshnik. Ukraine's Main Military Intelligence Directorate (GUR) stated on November 22 that Ukraine assesses that the IRBM that Russia launched on November 21 is actually a “Kedr” missile, which Russia has been developing since 2018-2019 in an effort to update the Yars ICBM model for shorter distances.[5] GUR Head Lieutenant General Kyrylo Budanov clarified that Ukraine believes that “Oreshnik” is the codename of the missile research and development project for the Kedr missile.[6] ISW cannot independently confirm these GUR statements, but it is noteworthy and consistent with ISW’s assessment that the November 21 Russian ballistic missile strike does not represent a fundamentally novel Russian capability.[7] Russia benefits from the rhetorical fanfare surrounding the November 21 strike and likely hopes that stoking concerns over the Oreshnik missile launch will prompt the West to dial back its support for Ukraine.

Russia may additionally conduct test launches of the same or similar ballistic missiles in the coming days to accomplish the same rhetorical effect. Russian sources claimed that Russia will close part of its airspace on November 23 to 24 for a missile test, but did not specify what type of missile Russian forces are testing.[8] GUR Deputy Chief Major General Vadym Skibitskyi warned on November 22 that Russia likely possesses up to 10 Oreshnik missiles and that Russia will likely conduct test launches for all these missiles in the future.[9]

Russian Mobilization and Force Generation Efforts (Russian objective: Expand combat power without conducting general mobilization)

Russia continues to build its training capacity by establishing new service academies in occupied Ukraine. Crimea occupation head Sergey Aksyonov appeared on live television to publicly appeal to Russian President Vladimir Putin and Director of the Russian Federal Security Service (FSB) Alexander Bortnikov to establish a border guard training academy in occupied Crimea.[81] Several Russian milbloggers welcomed Aksyonov's initiative and applauded his statements, acknowledging the importance of incorporating experience from Russia's war in Ukraine into border guard cadet training.[82] It remains unclear whether the Kremlin will approve Aksyonov's proposal as Ukrainian forces can strike much of Crimea with drones and missiles, placing Russian cadets at increased risk.[83] Aksyonov noted that Russian authorities will decide on this issue by the end of 2024.[84] Aksyonov's proposal is consistent with ISW’s previous assessments that Russian forces will likely expand training infrastructure - including in occupied Ukraine - to support the Russian military's reconstitution and expansion efforts.[85]

Russian authorities continue efforts to increase Russian irregular forces’ benefits. Russia's Ministry of Labor reportedly prepared an unpublished draft law that would raise the pension entitlements for disabled servicemen of the Donetsk and Luhansk People's Republics (DNR and LNR).[86] The draft law would provide wounded DNR and LNR servicemen benefits and compensation comparable to wounded and medically discharged regular Russian servicemen and would entitle DNR and LNR servicemen who fought in occupied Ukraine starting in 2014 access to two disability-centered pensions: one for old age and the other for length of service. ISW has previously assessed that the Kremlin's pivot to developing greater veteran support infrastructure is likely an effort to incentivize military service and proactively combat the risks associated with aggrieved veterans returning to civilian life.[87] The Ministry of Labor's proposed bill is a further indication of Russian authorities’ efforts to allocate more resources to Russia's growing veteran population and prevent disabled veterans from forming a disenfranchised cleavage with political power within Russian society. This bill also supports the Kremlin's efforts to formalize the DNR and LNR irregular forces and veterans and integrate them under the Russian Ministry of Defense (MoD).

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-22-2024

8,666 posted on 11/23/2024 12:24:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8617 | View Replies]

To: PIF; BeauBo; SpeedyInTexas; FtrPilot; gleeaikin; marcusmaximus; JonPreston
Adding to the rumor mill:

23NOV: “A serious signal has been received.” Putin is facing an assassination attempt because of “Oreshnik”?

Two sources in the FSB have provided us with alarming information. “A serious signal has been received. Vladimir Vladimirovich has scared several rather influential people with the use of the “Oreshnik” system and his plans for it. They are now afraid of a nuclear war, strikes on Moscow and other stupidities. And they have planned an assassination attempt on Vladimir Vladimirovich. We are currently developing probable suspects (sadly, there may be military personnel among them), conducting checks and investigative measures,” one of them said. He did not name the suspects, noting that “everything has its time, the information is still being verified.”

According to another source, the president's life may also be threatened by neo-Nazis (unfortunately, there are such people in Russia), who “will never forgive Vladimir Vladimirovich for the fact that we cannot liberate the Kursk region.” A similar assassination attempt on Putin, we recall, was prevented in the summer . Now destructive elements are raising their heads again “against the backdrop of a difficult situation in the country,” the FSB noted.

When asked whether enemy saboteurs could be preparing an assassination attempt on Vladimir Vladimirovich, the source replied: “This is a constant threat. But now there are problems with internal enemies. And something needs to be done about this.”

https://t.me/kremlin_secrets/4939

This describes the mood of the two sides in the Russian presidential administration.

8,667 posted on 11/23/2024 12:30:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8644 | View Replies]

To: AdmSmith

Resurrecting the “nazi” bogey man again
I see.

What does nazis and not taking Kursk back have in common?

Russian mir is quite fascinating


8,668 posted on 11/23/2024 4:17:55 AM PST by blitz128
[ Post Reply | Private Reply | To 8667 | View Replies]

To: AdmSmith
The russian Constitutional Court has ruled that contract soldiers cannot be released from military service until they reach 65 or 70 years of age, depending on their rank.

https://x.com/jurgen_nauditt/status/1860218120708980957


8,669 posted on 11/23/2024 5:35:31 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8667 | View Replies]

To: FtrPilot

That cartoon is misleading.

It shows operating tanks.


8,670 posted on 11/23/2024 5:39:02 AM PST by Vermont Lt
[ Post Reply | Private Reply | To 8669 | View Replies]

To: FtrPilot

Thought it was only Ukrainians who sent the elderly to the front😎


8,671 posted on 11/23/2024 5:39:28 AM PST by blitz128
[ Post Reply | Private Reply | To 8669 | View Replies]

To: BeauBo

Unfortunately, many still wrongly believe that Russia are the aggressors.

The US overthrew Ukraine via color revolution, took control via proxy, built a standing army on Russia’s border, supplied them with NATO weapons and training, and are now launching US missiles into Russia.… pic.twitter.com/gloj1fLYTs— Clandestine (@WarClandestine) November 22, 2024


8,672 posted on 11/23/2024 5:56:38 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8663 | View Replies]

To: blitz128
Speedo?


8,673 posted on 11/23/2024 5:58:55 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8668 | View Replies]

To: Vermont Lt

That cartoon is misleading. It shows operating tanks.

I’ve been watching those tanks for a while now and they have not moved.


8,674 posted on 11/23/2024 6:03:13 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8670 | View Replies]

To: AdmSmith

If NATO didn't exist we wouldn't be where we are now. If the Ukrainians weren't bombing the Dombas since 2013 we wouldn't be where we are now. If American biolabs weren't secretly operating in the Ukraine we wouldn't be where we are now. But it's all Russia's fault right?— The Architect. (@TheMarcitect) November 23, 2024


8,675 posted on 11/23/2024 6:09:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8667 | View Replies]


8,676 posted on 11/23/2024 6:11:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8675 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Secure Tactical Heights in a Bold Counterattack ]


Today [ Nov 23 ], there are a lot of updates from the Kurakhove direction.

Here, the Russians are trying to create a cauldron around the town of Uspenivka and take it, as it is a significant obstacle for their offensive effort to encircle a large group of Ukrainians. However, the Ukrainians were able to thwart Russian offensive efforts by deploying the elite Marine Corps that established a formidable defense belt and prevented the Russian penetration.

The town of Uspenivka and its fortifications are part of a larger defense line along the Sukhy Yaly River, which includes the villages of Uspenivka, Hannivka, Vesely Hai, Romanivka, Illinka, Yelyzavetivka, and Katerynivka. For the past month, the main Russian axis of advance in this area was from the east in the area of Katerynivka.

The Russian plan here was to engage in a slow grinding battle for control of the towns along the Sukhy Yaly River one by one, which was expected to last for years.

However, for Russians to approach Yelizavetivka, after a month of intense fighting for the town of Katerinovka, they had to cross the Solodka River which is a tributary to Sukhy Yali, merging the two rivers and enhancing the Ukrainian defense with a natural barrier.

To make matters worse for the Russians, with the narrow width of the Sukhy Yaly River valley Russian forces do not have much space to maneuver, exposing them as vulnerable against Ukrainian FPV drones covering the area as their route of advance is predictable. Combat footage from the area reveals how drone operators of the Ukrainian 79th Assault Brigade managed to destroy or damage five Russian armored vehicles in 2 days.

Furthermore, the only bridge that enables any crossing to the Ukrainian side of Sukhy Yaly and Solodka Rivers in this frontline section is destroyed. The attempt of a such river crossing could result in way higher losses for the Russians, and the potential risk of rendering their units combat ineffective from such an operation. This made the Russian command consider a change to their approach, instead switching their focus from Yelyzavetivka to Uspenivka.

After the large Russian territorial gains after the fall of Vuhledar, they were able to approach the Sukhy Yaly defense line from the south and from the north from Dalne, as a result of their offensive towards Kurakhove. The goal of Russian forces in the area of the Sukhy Yaly line is to approach the Ukrainian defenses from 2 pincers by approaching Uspenivka. Uspenivka is the main highway intersection and the main supply hub of the Ukrainian forces in the Sukhy Yali defense line.

If the Russians take over Uspenivka, the Ukrainian forces in the rest of the Sukhy Yaly line would be forced to withdraw, abandoning their positions to the Russians without resistance.

However, the Ukrainians identified a critical weak spot in the Russian positions that consisted of less defended line of trenches. These positions are located in an elevated area, overlooking the highway to Uspenivka and Russian rear positions in the lowlands.

By controlling them the Ukrainian fighters would be able to cancel the planned Russian assault on Uspenivka by establishing fire control of their axis of advance along the highway, thus forcing the Russians to try and retake control of the tactical elevation.

In order to execute this operation, the Ukrainians deployed their elite Marine Corps, modeled after the US Marines, to storm the Russian positions to the south of Uspenivka. The Marines were deployed on US-supplied M-ATV Oshkosh armored vehicles, which effectively suppressed Russian trenches with their machine-gun fire, enabling the dismounting marines to storm Russian trenches.

After a prolonged battle, they were able to take the Russian positions to the south of Uspenivka and capture several Russian soldiers, which revealed critical information about their planned operations.

Overall, the Ukrainians managed to undermine the Russian operations along the Sukhy Yali line by first forcing them to try and attack from the south in an attempt to create a pincer, only then for the Ukrainians to cancel the formation of this pincer, threatening the whole line of advance by holding tactical elevations.

These developments on the frontline will force the Russians to switch their focus from Uspenivka to the positions retaken by the Ukrainian fighters, delaying their planned attacks on Uspenivka by weeks or even months. This will buy time for Ukrainian forces defending the area of Uspenivka to reinforce the fortifications around the village, which is already guarded by two powerful strong points to the north and south of the village.


8,677 posted on 11/23/2024 6:14:38 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8669 | View Replies]

To: PIF; Vermont Lt

I believe the picture is an accurate depiction of a ruzzian wave attack.

The tanks are the blocking troops, positioned so the wave moves forward.


8,678 posted on 11/23/2024 6:15:26 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8674 | View Replies]

To: JonPreston

“many still wrongly believe that Russia are the aggressors.”

Are they going to believe you, or their own lying eyes?

It is just blatantly clownish to try to argue that Russia is not the aggressor, after years of full scale high intensity attack, destroyed cities, mountains of bodies, and the widespread, systematic, planned use of torture.

Russia’s industrial scale war crimes and atrocities will stain Russians in the eyes f the world, for generations to come.

Punishment is deserved.


8,679 posted on 11/23/2024 6:16:38 AM PST by BeauBo
[ Post Reply | Private Reply | To 8672 | View Replies]

To: JonPreston

“it’s all Russia’s fault right?”

Right.

No one has the the right to conduct armed robbery and mass murder to force other people into servitude.


8,680 posted on 11/23/2024 6:21:49 AM PST by BeauBo
[ Post Reply | Private Reply | To 8675 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,641-8,6608,661-8,6808,681-8,700 ... 20,181-20,191 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson