Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,601-8,6208,621-8,6408,641-8,660 ... 20,301 next last
To: JonPreston

UP TO 50% OF Ukraine MONEY STOLEN

"A huge part of the funds was stolen in Ukraine. From 30% to 50% independent of the direction. From the stolen money, it is possible to put together an annual support budget for Ukraine"

— former Polish Minister of Labor Piotr Kulpa pic.twitter.com/ixgnNcRDBN— Lord Bebo (@MyLordBebo) November 21, 2024


8,621 posted on 11/22/2024 4:19:26 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8620 | View Replies]

To: BeauBo

The Story Of Russia’s Secretive RS-26 Intermediate Range Ballistic Missile
The Oreshnik missile that Russia used today in Ukraine has roots in the supposedly defunct RS-26 Rubezh ballistic missile program.
https://www.twz.com/land/the-story-of-russias-secretive-rs-26-intermediate-range-ballistic-missile


Russia’s Experimental Ballistic Missile Used To Strike Ukraine Is Based On The RS-26 Rubezh
Details are emerging about Russia’s new ‘Oreshnik’ ballistic missile and its genesis.
https://www.twz.com/land/russias-experimental-ballistic-missile-used-to-strike-ukraine-is-based-on-the-rs-26-rubezh


Russia’s Unprecedented Ballistic Missile Attack On Ukraine: What We Know
Russia has used a more capable ballistic missile than ever before to strike Ukraine with what appear to be multiple warheads.
https://www.twz.com/news-features/russias-unprecedented-ballistic-missile-attack-on-ukraine-what-we-know


Watch A Ukrainian Uncrewed Aerial Mothership Launch Kamikaze Drones
Using uncrewed aerial platforms to launch and provide connectivity for first-person view drones help overcome many of the latter’s deficiencies.
https://www.twz.com/air/watch-a-ukrainian-uncrewed-aerial-mothership-launch-kamikaze-drones


Danish Navy Shadows Chinese Cargo Ship After Baltic Sea Cable Damage
The Chinese ship, the Yi Peng 3, is now anchored, with a Royal Danish Navy patrol boat alongside it.
https://www.twz.com/news-features/danish-navy-shadows-chinese-cargo-ship-after-baltic-sea-cable-damage


U.S. Embassy In Kyiv Temporarily Closed Due To Russian Airstrike Threat
The rare move to close the embassy was followed by Ukrainian officials claiming Russia is spreading false info to stoke fear.
https://www.twz.com/news-features/u-s-embassy-in-kyiv-temporarily-closed-due-to-russian-airstrike-threat


Army Arsenal Seeking Info On Mysterious Drone Flights Over Installation
This marks the latest incident of multiple reports of drones of unknown origin being spotted over U.S. military facilities.
https://www.twz.com/air/army-arsenal-seeking-info-on-mysterious-drone-flights-over-installation


8,622 posted on 11/22/2024 4:27:51 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8616 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Forces Destroy Russian Pincer Strategy ]


Today [ Nov 22 ], there are a lot of updates from the Kurahove direction.

Here, amid escalating efforts to bypass fortified defenses, Russian forces focused on a turning maneuver aimed at forcing Ukrainian withdrawals and capturing key settlements without direct confrontation. However, so far Ukrainian forces managed to disrupt this operation through relentless counterattacks, forcing the Russians to revert to costly frontal assaults and continue fighting on terms dictated by the defenders.

Kurakhove is a key town for a potential Russian advance toward Pokrovsk, making it the focus of an aggressive offensive aimed at capturing it, while minimizing urban clashes. With a pre-war population of 20,000, Kurakhove also hosts significant industrial facilities, including a large thermal plant.

Although damaged by Russian attacks in October 2022, the plant’s fortified structures could serve as defensive strongholds for Ukrainian forces. To circumvent these challenges, Russian forces have intensified their southern advances, aiming to sever the N15 highway - a critical supply route for Ukrainian troops and ammunition.

As detailed in the previous report, Russian forces have launched a multifaceted offensive, employing various tactics to advance. This includes deploying small infantry groups to infiltrate plantations and villages, creating a gradual buildup of forces.

These maneuvers, often referred to as “bag tactics,” involve encircling Ukrainian positions by spreading out in a comb-like formation. This method aims to “box in” Ukrainian troops, forcing them into untenable positions and compelling retreats under pressure from attacks on multiple flanks.

The geography of the area poses significant challenges for Ukrainian defenders. If we look at the topographic map, we can see that Ukrainian-held settlements are situated in lowlands, while Russian forces advance from higher terrain.

This elevation advantage enables Russian troops to exert effective fire control, target Ukrainian positions with long-range artillery, and closely monitor their movements. In response, Ukrainian forces have begun regrouping closer to a line of settlements that offer more favorable defensive positions and improved logistical support for troop movements and supplies.

Recent reports highlight a concentrated Russian effort to advance toward Dalne. Their objective here is a flanking maneuver through Dalne, aimed at creating the threat of operational encirclement, and bypassing the need to fight for each settlement along the line - where they have been incurring heavy losses.

With limited reserves and time, Russian forces cannot afford to confront every village individually. Aware of this strategy, the Ukrainian command has launched continuous counterattacks on Dalne, effectively disrupting Russian attempts to establish firm control over the area.

Dalne, a small settlement with limited potential for establishing strong defensive positions, is partially shielded to the south by tree lines. However, even if Russian forces attempt to secure a foothold here, their options for advancing westward through open fields are severely constrained by the nearby Ukrainian trench networks south of Kurakhove and the major defensive base at Uspenivka.

Ukrainian counterattacks in the area rely on swift, targeted operations supported by armored vehicles and MRAPs, aiming to disrupt Russian troop concentrations and repel mechanized breakthrough attempts.

Geolocated footage captured a striking Ukrainian operation in which a camouflaged Leopard tank destroyed an entire Russian armored column advancing toward Dalne. Unaware of the Leopard’s position, the column moved forward until it came under direct fire, resulting in the destruction of most Russian vehicles before they could react.

One armored vehicle attempted to escape by reversing, but its slow retreat made it an easy target for the Leopard. The few Russian soldiers who survived and sought cover were later neutralized by grenades dropped from Ukrainian drones, showcasing the effective coordination of ground and aerial assets in the operation.

The deployment of tanks and armored vehicles by Ukrainian forces, demonstrates their ability to maintain operational flexibility, including secure routes for moving and extracting armor, as well as for logistical supplies or a potential withdrawal.

While recent reports indicate that Russian forces have partially entered Dalne, intense class clashes for control of the settlement are still ongoing. Russia’s advance to Dalne has significantly stretched their supply lines, leaving their hold on the area tenuous. This presents Ukrainian forces with a strong opportunity to disrupt Russian logistics and regain the initiative.

Overall, the Russian focus on DNA reflects their strategy to achieve an operational encirclement of the entire settlement line, where they have been incurring heavy losses.

Aware of this intent Ian forces are conducting continuous counterattacks to delay Russian progress; the longer the Russians are kept from securing Dalne the more they are forced to rely on costly frontal assaults on fortified settlements further south.

If Ukrainian forces can hold down long enough. Russian forces risk exhausting their offensive capacity before reaching their operational objectives, potentially forcing them into a prolonged post to replenish reserves.


8,623 posted on 11/22/2024 4:41:55 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8616 | View Replies]

To: AdmSmith

"We are ready to fight Putin in Eastern Europe"

-Robert Magowan, UK Deputy Chief of Defence Staff pic.twitter.com/AyimQT3ElP— Richard (@ricwe123) November 22, 2024


8,624 posted on 11/22/2024 4:45:04 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8601 | View Replies]

To: blitz128
Have you seen Speedy?


8,625 posted on 11/22/2024 4:47:56 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8600 | View Replies]

To: BeauBo

🇷🇺🇺🇦⚡- "Some officials in the United States and European countries have proposed returning to Kiev the nuclear weapons that Ukraine gave up after the collapse of the USSR," - The New York Times.— Zlatti71 (@Zlatti_71) November 22, 2024


8,626 posted on 11/22/2024 4:53:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8604 | View Replies]

To: AdmSmith; PIF
🔥 Explosions in Krasnodar right now.

https://x.com/albafella1/status/1859699224432275476

🔥 More footage from Krasnodar now.

Everything is according to plan 😌

https://x.com/albafella1/status/1859699912583401800


8,627 posted on 11/22/2024 5:04:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8618 | View Replies]

To: PIF
No more motorcycles: Putin’s elite are now using LADA small cars in assaults.

It did not end well.

https://x.com/wartranslated/status/1859677980748022169


8,628 posted on 11/22/2024 5:07:18 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8627 | View Replies]

To: BeauBo
🔥A 🇷🇺 Russian BMP-3 hit a mine that had been remotely mined by octocopter.

🇺🇦 414th Regiment «Birds of Magyar»

https://x.com/GloOouD/status/1859680369563533478

Remote mining...what a concept.

8,629 posted on 11/22/2024 5:11:43 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8628 | View Replies]

To: BeauBo
103.25 😳

https://x.com/Maks_NAFO_FELLA/status/1859881040183173483


8,630 posted on 11/22/2024 5:14:32 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8629 | View Replies]

To: PIF
The Russian city of Engels in Saratov region is drowning in fecal sewage. Russian Telegram channels report that a diver has come to the rescue of residents.

They are complaining about sewage flowing through the streets, flooded basements and neighborhoods. Faeces are leaking out and flooding walkways and children's playgrounds, messages say.

https://x.com/Gerashchenko_en/status/1859643043156046157

Divers wanted.


8,631 posted on 11/22/2024 5:18:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8630 | View Replies]

To: PIF
Despite several major Russian offensives, the Ukrainian-held Sudzha pocket in the Kursk region is holding. According to my estimates, Ukraine holds around 670 square kilometers (230 square miles) of Russian territory.

The newly formed Russian attack formations, which are made up by Russian paratroopers and marines, have experienced in the last days and weeks extremely high casualties. The presence of Russia's elite formations not only shows the importance of the matter but also the urgency. Moscow is hellbent to retake this territory, but until this point failed miserably to do so.

I know that there are some even in Ukraine who had doubts about the soundness of the Kursk operation, but I have always been convinced that once a permanent foothold could be established then it would have been worthwhile, and it has been. This patch of land makes it extremely difficult for the Russian regime to stop all operations and look for a ceasefire. Not mentioning the monumental embarrassment Russia experienced by this operation alone.

As long as the Ukrainian flag waves over Russian territory, ceasefire talks are not going to happen, respectively, they put an extremely high price tag for any negotiations, higher than what is going on in Donbas. This puts Russia in the difficult position and forces Moscow to allocate more and more resources into this sector, especially for the upcoming weeks before the Trump administration is sworn in.

Putin is aiming for ceasefire. Russia is in far worse shape than many realize, but before he can even consider that, he is going to throw in a lot Russian and North Korean meat into this grinder. And Ukraine will certainly make sure that this grinder is a perfectly oiled machine.

https://x.com/Tendar/status/1859919256890015981


8,632 posted on 11/22/2024 5:29:10 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8631 | View Replies]

To: PIF
🇺🇦 Soldiers of the SSO caught the killers from the 🇷🇺 810th brigade of marines. In Kursk Region.

https://x.com/Vijesti11111/status/1859549466589647241

Kursk!


8,633 posted on 11/22/2024 5:32:13 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8632 | View Replies]

To: JonPreston

“Some officials in the United States and European countries have proposed returning to Kiev the nuclear weapons that Ukraine gave up after the collapse of the USSR”

Because of Putin.

He is a Master Strategist.


8,634 posted on 11/22/2024 5:44:28 AM PST by BeauBo
[ Post Reply | Private Reply | To 8626 | View Replies]

To: FtrPilot

“103.25 😳”

It’s hitting the fan now.

The significant financial buffers have been exhausted. The can can no longer be kicked down the road.

There are multiple crises now emerging in Russia’s economy and finances (not “going to be”, they are here).

The reserves are exhausted, and now they must cut to the bone. People will have to painfully do without. No more shielding the impact from the population, including the Moscow and Leningrad elites.

In the premier cancer treatment center in Moscow (for the elite), the doctors just had their pay cut 30%. The biggest property developer in Russia is facing bankruptcy. Train cargo shipments have slowed to a crawl.

A collapse in the currency will break several systems vital to the economy. But the headline event will likely be hyperinflation. Pity the poor Russian retirees.

So the Ruble Deathwatch raises to DeathCon 2, as we accelerate past the 100 to 1 mark.

Opinions among the Russian Central Bank Governors varied, as to what exchange rate would inflict irreversible damage to the general Russian economy. Estimates varied between 150 and 200 to the dollar. Even 120 to the dollar was expected to start killing some sectors.

It seems that the defenses have been breached, and there mow may be an open field ahead for the market to correct the exchange rate of the ruble, down into the death zone.

Putin did that.


8,635 posted on 11/22/2024 6:32:38 AM PST by BeauBo
[ Post Reply | Private Reply | To 8630 | View Replies]

To: BeauBo

Properties in the Far East just became cheaper for Chinese purchases.


8,636 posted on 11/22/2024 6:43:16 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8635 | View Replies]

To: PIF

“Properties in the Far East just became cheaper for Chinese purchases.”

I recommend that they hold off on their purchase, until after the Central Bank Chief’s tragic window accident. That will be the real fire sale.

After Elvira, comes the deluge - or when the deluge comes anyway, Elvira takes the blame. Her passing from the scene remains a key indicator to watch for.


8,637 posted on 11/22/2024 7:02:49 AM PST by BeauBo
[ Post Reply | Private Reply | To 8636 | View Replies]

To: BeauBo

Cassandra Peterson as Elvira, Mistress of the Dark in her TV costume.
8,638 posted on 11/22/2024 7:11:48 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8637 | View Replies]


8,639 posted on 11/22/2024 8:09:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8568 | View Replies]

To: AdmSmith

Kremlin snuff box, 11/21/24
https://t.me/s/kremlin_secrets

Will there be a war with NATO? And why did Putin react this way to Western missile attacks?

We talked to a large number of sources - in the Kremlin, the Ministry of Defense, the government. And we tell you what our elites think about Vladimir Putin’s address dedicated to the response to attacks by Western weapons deep into Russian territory. And about the use of the Oreshnik rocket. There are several important points.

Firstly, opinions were radically divided. Some praise Vladimir Vladimirovich, others are afraid. “I told you we would beat Trump . Consider yourself already started!”, a source in the Kremlin said joyfully.

But another - a well-known politician whose name we will not name - fears escalation. “I’m under sanctions, so I can’t leave for a normal country. And in general, they say that soon officials of my level will not be allowed to go abroad. So that ordinary people don’t start leaving. To be honest, I’m afraid,” our interlocutor admitted.

Another representative of the AP condemned such words and said that “We will definitely defeat the West. And the traitors and cowards need to be cleaned out now.”

Secondly, most sources agree that there will be no war with NATO. Why, the information is secret, we will not disclose it to our enemies. “We are no strangers to bombing crests! And they already seem to have gotten used to it. And, you see, they snap,” the interlocutor at the Ministry of Defense noted philosophically.

Thirdly, the President perceived Western missiles flying deep into Russia as his personal problem. “Vladimir Vladimirovich really began to spend less time in public, the FSO strengthened security measures ( we wrote about this - ed. ). He probably doesn’t like it very much,” explained an official close to Putin.

Fourthly, after the President’s address, the military expects “serious decisions” on mobilization and partial demobilization. Nobody says which ones exactly. But, according to sources, Valery Gerasimov ( who insists that the army needs to be replenished with new military personnel ) was in an excellent mood after Vladimir Vladimirovich’s speech.

By the way, after Putin’s address, philosopher Alexander Dugin contacted us. “And I told you that Russia will fight for another 40 years. You see! Be sure to write that I was right!” he said.


8,640 posted on 11/22/2024 8:20:28 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8639 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,601-8,6208,621-8,6408,641-8,660 ... 20,301 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson