Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,541-8,5608,561-8,5808,581-8,600 ... 18,661-18,674 next last
To: FtrPilot

NATO and USAF Black Sea ISR flights near Crimea getting real interesting right this minute.


8,561 posted on 11/20/2024 3:32:22 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 8558 | View Replies]

To: marcusmaximus
I have seen some cryptic hints on x.com.

Perhaps, "tonight's the night".

8,562 posted on 11/20/2024 3:38:41 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8561 | View Replies]

To: FtrPilot; marcusmaximus

Denys Davidov reports about 10 Storm Shadows hit that underground Command Post, possibly targeting North Korean Generals


8,563 posted on 11/20/2024 9:05:37 PM PST by BeauBo (k)
[ Post Reply | Private Reply | To 8556 | View Replies]

To: PIF

Lights out in Cuba.

Nationwide blackouts, as Russian oil supply dries up, and Venezuelan supplies were cut in half.

90% of their electricity generation is from oil.


8,564 posted on 11/20/2024 9:31:45 PM PST by BeauBo (k)
[ Post Reply | Private Reply | To 8549 | View Replies]

To: PIF
🔥A 🇷🇺 Russian invader decided to play baseball against a 🇺🇦 Ukrainian FPV drone. He lost. 😁

https://x.com/GloOouD/status/1859486623731228740


8,565 posted on 11/21/2024 3:06:21 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8560 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, November 20, 2024

Russian Mobilization and Force Generation Efforts (Russian objective: Expand combat power without conducting general mobilization)

The Russian military command’s poor treatment of and failure to support Russian soldiers is likely contributing to mass desertions. Russian opposition outlet Vazhnye Istorii (iStories) reported that an internal Russian Ministry of Defense (MoD) document detailed how over 1,000 Russian servicemembers, including officers, deserted the Russian 20th Motorized Rifle Division (MRD) (8th Combined Arms Army [CAA], Southern Military District [SMD]) as of April 20, 2024 – well over a battalion’s worth of personnel.[78] iStories reported that the command of the Russian 20th MRD appealed to the Russian MoD for assistance in returning deserters and interviewed personnel of the 20th MRD’s 33rd and 255th motorized rifle regiments, who attributed the desertion rates to high casualties, lack of promised payments to soldiers, and the practice of sending injured and sick soldiers on assaults. These complaints mirror frequent Russian ultranationalist milblogger complaints about the Russian MoD’s poor treatment of Russian military personnel, and the alleged internal document indicates that the MoD is likely aware of the scale of Russian morale problems.[79] Russian opposition outlet Mobilization News amplified footage on November 19 showing soldiers from the Russian 36th Motorized Rifle Brigade (29th CAA, Eastern Military District [EMD]) appealing directly to Russian Defense Minister Andrei Belousov complaining about how their commanders sent them on assaults without reconnaissance or artillery support.[80] The Russian soldiers claimed that they have to use their salaries to purchase their own equipment and fortification materials because the military command does not provide them.

High Russian casualties are reportedly prompting the Russian government to increase spending to identify dead personnel amid broader Kremlin concerns about Russia’s long-term economic stability.[81] Russian opposition outlet Verstka reported on November 19 that the Russian federal government has allocated over 180 million rubles (about $1.7 million) to Russian federal subjects for DNA tests to identify Russian soldiers’ bodies so far in 2024, the highest annual amount dedicated to such a type of spending since the start of the war.[82]

The Russian MoD seems to be struggling to completely incorporate former private military companies (PMCs) into the Russian military. Russian State Secretary - Deputy Defense Minister Anna Tsivileva announced on November 19 that the Russian MoD will issue veteran certificates to former PMC fighters based on notarized “eyewitness accounts” from several witnesses confirming that the fighter fought in the war in Ukraine and that the MoD should cover notarization expenses.[83] Tsivileva did not specify who the MoD considers a valid eyewitness. The increased burden on former PMC fighters, particularly former Wagner personnel who did not sign contracts with the Russian military, to prove that they are eligible for veteran status compared to regular Russian personnel will likely contribute to tensions between Wagner personnel, regular Russian personnel, and the MoD.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-20-2024


8,566 posted on 11/21/2024 3:10:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8521 | View Replies]

To: PIF
Overnight a Ukrainian drone successfully struck "an industrial facility" in the Konstantinovsky district of Russia's Rostov region.

Another region of Rostov was also attacked by drones & Volgograd airport was temporarily closed.

https://x.com/GlasnostGone/status/1859511095351791619


8,567 posted on 11/21/2024 3:11:02 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8565 | View Replies]


8,568 posted on 11/21/2024 3:12:16 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8523 | View Replies]

To: AdmSmith
Russia’s use of an ICBM armed with a conventional warhead against #Ukraine is a tepid attempt to inspire fear in the west.

The only thing it should inspire is increased western support for Ukrainian air defense and long-range missile strikes against Russia.

https://x.com/berlin_bridge/status/1859535751769182307


8,569 posted on 11/21/2024 3:37:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8568 | View Replies]

To: PIF
The 3rd Assault Brigade repelled a Russian mechanized attack in the Kharkiv region.

After one armored vehicle blew up on a mine, the assault groups scattered across the fields.

The remains of these groups and their equipment were neutralized by artillery, cluster munitions and FPV drones.

https://x.com/NOELreports/status/1859561641530265896

Trifecta


8,570 posted on 11/21/2024 3:42:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8569 | View Replies]

To: PIF

8,571 posted on 11/21/2024 4:25:45 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8560 | View Replies]

To: BeauBo

10 was my count of hits also - from the video


8,572 posted on 11/21/2024 4:30:22 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8563 | View Replies]

To: SpeedyInTexas

8,573 posted on 11/21/2024 4:31:55 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7826 | View Replies]

To: FtrPilot

What did it hit? Was it only a Russian claim?


8,574 posted on 11/21/2024 4:33:29 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8569 | View Replies]

To: PIF

The Russian ruble is down over the last 15 year period.

It is also down over the last 10 year, 5 year, 1 year, 6 month, 3 month, 1 month, 1 week or 1 day timeframe.

I am seeing a pattern, of Putin destroying the ruble, among his many other victims.


8,575 posted on 11/21/2024 4:58:02 AM PST by BeauBo
[ Post Reply | Private Reply | To 8572 | View Replies]


8,576 posted on 11/21/2024 5:41:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8570 | View Replies]

To: PIF; marcusmaximus; BeauBo
The RS-26 was aimed at the Ukrainian city of Dnipro.

In the videos that I have seen, there are no explosions.

My guess is that the missile was launched with inert warheads. No time to manufacture HE warheads to exact specifications.

The missile was not launched at Kyiv for fear that Patriots would shoot it down.

All in all, the launch was a testament to ruzzian stupidity.

It clearly caught the attention of the FRchickenlittles.

8,577 posted on 11/21/2024 5:51:06 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8574 | View Replies]

To: BeauBo; PIF
"Lights out in Cuba.
Nationwide blackouts, as Russian oil supply dries up, and Venezuelan supplies were cut in half.
90% of their electricity generation is from oil."

In Havanah, Cuba, a winter's lowest temperatures typically reach around 65 degrees Fahrenheit (18 C).
So, a loss of electric power in Cuba will not be as life-threatening to Cubans as it will be to civilians this winter in Ukraine or Russia.

8,578 posted on 11/21/2024 5:59:44 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 8564 | View Replies]

To: BeauBo
In Russia, due to technical issues, half of the Airbus A320/A321neo fleet has been grounded.

34 planes are out of service, with some put into reserve to save engine resources.

The issue lies in the problematic engines, which can't be repaired locally or imported due to sanctions.

https://x.com/NOELreports/status/1859563093849739527


8,579 posted on 11/21/2024 6:07:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8577 | View Replies]

To: PIF
Another Russian assault group on civilian unarmored vehicle targeted by FPV.

https://x.com/bayraktar_1love/status/1859565357528207856


8,580 posted on 11/21/2024 6:26:41 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8579 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,541-8,5608,561-8,5808,581-8,600 ... 18,661-18,674 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson