Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,441-8,4608,461-8,4808,481-8,500 ... 18,661-18,677 next last

8,461 posted on 11/19/2024 5:00:29 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8458 | View Replies]

To: marcusmaximus; PIF; AdmSmith
Ukrainian war correspondent Butusov states that Defense Forces struck a military target in Russia with U.S.-made ATACMS ballistic missiles, citing a General Staff report.

“On the night of November 19, 2024, units of the Armed Forces of Ukraine, in coordination with other components of the Defense Forces, carried out a strike on the arsenal of the 1046th Logistics Center near the city of Karachev, Bryansk region of the Russian Federation. As of 2:30 AM, 12 secondary explosions and detonation were recorded in the target area.

The targeting of ammunition depots for the Russian occupying forces, aimed at halting Russia's armed aggression against Ukraine, will continue.”

https://x.com/wartranslated/status/1858799124893581636

ATACMs or Storm Shadow, the explosion in the video is big.

8,462 posted on 11/19/2024 5:37:57 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8452 | View Replies]

To: PIF
The paratroopers of the 95th Air Assault Brigade keep repelling the Russian marines of the 810th Brigade in the Kursk region.

Russians are desperately trying to reach Ukrainian positions.

https://x.com/NOELreports/status/1858765564723802117


8,463 posted on 11/19/2024 5:45:00 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8462 | View Replies]

To: blitz128
🚀🔥 BAVOVNA… 67th GRAU arsenal in Karachev, Bryansk region.

https://bsky.app/profile/maks23.bsky.social/post/3lbbbmvvus22l

🚀💥🔊 ATACMS strike on arsenal in Karachev, Bryansk region

https://bsky.app/profile/maks23.bsky.social/post/3lbcjm7xuxk2i


8,464 posted on 11/19/2024 5:45:30 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8457 | View Replies]

To: PIF
Boom!🔥🍞

A 152-mm self-propelled guns 2C19 "Msta-S" explodes big style!

Paratroopers of the 77th Airmobile Brigade in the Kupyansk direction.

https://x.com/ChallengerInUA/status/1858598105324617816


8,465 posted on 11/19/2024 5:47:33 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8463 | View Replies]

Say cheese Ivan.

https://x.com/NAFORaccoon/status/1858573494436450577


8,466 posted on 11/19/2024 5:50:01 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8465 | View Replies]

To: FtrPilot

⚡️Lithuanian President Gitanas Nauseda had a phone call with Trump. During the conversation, they discussed the war in Ukraine and cooperation between authoritarian regimes — LRT

In particular, Nauseda and Trump spoke about “the negative impact of cooperation between Russia, China, Iran and North Korea on the international security architecture”.

Nauseda also said that he welcomed Trump’s vision of achieving peace “through a demonstration of strength”. The conversation emphasized the need to support Ukraine in its fight against Russian aggression, in order to “contain the ambitions of other authoritarian regimes”.

https://x.com/front_ukrainian/status/1858835779767988321


8,467 posted on 11/19/2024 5:53:20 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8466 | View Replies]

To: PIF
ATACMS flew more than 140 km and hit a target in the Bryansk region, russia.

This means that the strike permit applies not only to Kurshchyna, as the Western media wrote about it. This attack also showed that the air defense of the russian Federation will have big problems with Ukrainian missiles.

Meanwhile, Alkonaut Medvedev threatens a nuclear attack on Kyiv and NATO countries.

https://x.com/jurgen_nauditt/status/1858798484184346865


8,468 posted on 11/19/2024 5:53:49 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8466 | View Replies]

To: PIF
Russian MoD surprisingly confirms the ATACAMS launch against a target in the Bryansk region, though claims that most missiles were 'intercepted'.

https://x.com/wartranslated/status/1858848767090229726

No casualties or damage!

Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha Ha


8,469 posted on 11/19/2024 6:13:09 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8468 | View Replies]

To: FtrPilot; PIF

U.S. ISR flights over the Black Sea are back scoping out Crimea.


8,470 posted on 11/19/2024 6:15:01 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 8468 | View Replies]

To: JonPreston

You are right, MR high IQ, interesting how you never consider that Putin should never had started it in the first place🤔


8,471 posted on 11/19/2024 6:15:12 AM PST by blitz128
[ Post Reply | Private Reply | To 8458 | View Replies]

To: FtrPilot
At least 5 086 Russian officers have been eliminated in the Russian invasion of Ukraine since 24 February 2022.
Weekly update: +47 newly registered.
This figure is confirmed by Russian obituaries, graves and memorial plaques. Sources can be found in our spreadsheet.

https://x.com/KilledInUkraine/status/1858165911649137061

WAR IN #UKRAINE - NOV 18, 2024

■ Yesterday's attack: Record missiles used (85% intercepted), 8th highest drone losses
■ Also 7th highest vehicle losses (landbased losses close to 7-day average)
■ KIU: +47 officers; 6.4 per day for last four batches ⬆
■ Air & artillery strikes on both sides above average, improved strike ratio

See dashboard for further dat

https://x.com/ragnarbjartur/status/1858433790231580908

8,472 posted on 11/19/2024 6:18:32 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8469 | View Replies]

To: AdmSmith
A video of the moment when the car of the Russian war criminal and Chief of Staff of the 41st Brigade of Missile Ships and Boats of the Russian Black Sea Fleet in Russian-occupied Sevastopol was blown up, has appeared online

The video shows Russian Captain Valery Trankovsky driving along Taras Shevchenko Street. At that moment an improvised explosive device is activated. It was attached at the bottom of the car on the driver's side. The explosive, reportedly containing about 100 grams of TNT, was detonated remotely using a mobile, subsequently killing the Trankovsky.

The elimination of this Russian war criminal was conducted on November 13. Due to his involvement in the shelling of numerous Ukrainian cities, he was on the lists of Ukrainian intelligence services since last year.

https://x.com/Tendar/status/1858796910976336202


8,473 posted on 11/19/2024 6:27:18 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8472 | View Replies]

To: PIF
The Ukrainian Air Force reported on a Shahed drone attack overnight. Out of 87 Shaheds launched, 51 were shot down and 30 more were supressed by electronic warfare. One UAV remains in Ukrainian airspace.

https://x.com/NOELreports/status/1858781968156004761


8,474 posted on 11/19/2024 6:29:26 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8473 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Roulette. Only 4 Soldiers Crossed the Minefield. Called a Success. ]


Today [ Nov 19 ], there are a lot of important updates from the Pokrovsk direction [ west of Adiivka ].

Here, the Russians launched the next phase of their offensive on Pokrovsk, trying to overcome the Ukrainian defenses with large mechanized assaults. Despite the detailed plan of operations in the Pokrovsk region, the Russian forces ran into numerous setbacks which completely deranged their operations.

The Russian offensive is focused on 3 main vectors of attack. To the southwest, the goal is to advance along the railway embankment from Selydove toward settlements south of Pokrovsk, ultimately reaching Shevchenko. This would expand their bridgehead south of the city and allow them to target key supply routes west of Pokrovsk with anti-tank guided missiles, mortars, and artillery.

From the northeast, Russian forces from Hrodivka and Novohrodivka aim to enter Myrnograd and engage in urban combat, with the objective of disrupting supply lines to Pokrovsk by putting the city’s road network under fire control.

Ukrainian commanders anticipated the Russian assault routes and used the period of Russian recuperation to establish multi-layered defenses. They deployed remote mining systems to strategically place anti-tank mines along key paths of advance, while drone units were sent to monitor the area around Selydove, enabling rapid responses to Russian movements.

The open fields and roads were heavily mined, and Ukrainian forces stationed troops in Yurivka, Petrivka, Hryhorivka, and Novoaleksandrivka, ready to engage Russian stormtroopers weakened by prior losses. This strategy created a strong, multi-layered defense that shifted the tactical advantage to Ukraine.

Russian plans to cut off Ukrainian supply lines on the northern flank are largely unfeasible, due to disorganized and inadequate logistical support in this sector. As a result, Russian efforts are focused on strengthening the southern flank around Pokrovsk. In this region, Selydove serves as a critical hub for troop concentration and logistical support.

Unlike Hrodivka to the north, which has suffered extensive damage, Selydove remains largely intact, facilitating smoother logistics. However, Russian forces seem unprepared for the depth and resilience of the Ukrainian defenses around Selydove, complicating their advance.

The strong logistical support in the area enabled Russian forces to launch more intense and sustained assaults, concentrating their efforts to the west of Selydove. They initiated attacks along the railway embankment, targeting the towns of Petrivka and Hryhorivka, as well as Novoaleksandrivka and Yurivka to the south.

Combat footage from the area reveals the involvement of Russian mechanized forces, including T-80BVM tanks, BMP-2 infantry fighting vehicles, and Chinese Desertcross ATVs, along with golf carts used for troop transport.

Unfortunately for the Russians, many of these vehicles - tanks, BMPs, and unarmored ATVs - were destroyed due to the rapid response of Ukrainian drone operators, who had anticipated the assaults.

Alongside drone strikes, the Ukrainians used remote mining tactics to further disrupt Russian forces, detracking several T-80BVM tanks and forcing their crews to abandon them. This provided an opportunity for Ukrainian drones to destroy the abandoned vehicles, causing additional losses for the Russian forces.

As a result, the Russian soldiers who managed to escape their vehicles were forced to continue the assault on foot, only to be easily detected. Packed together in a “meat-wave” formation, they became prime targets for Ukrainian drone operators, who ambushed them and inflicted heavy losses as the Russians tried to take cover in nearby tree lines.

Ultimately, the surviving Russian soldiers managed to infiltrate a small area around Yurivka, Novoaleksandrivka, and Hryhorivka, west of Selydove, establishing a foothold. However, the assault units suffered severe casualties, significantly weakening their offensive capabilities.

Overall, the Russians launched a downscaled assault west of Selydove, facing mounting losses that slowed their progress. In one instance, only 4 out of 30 soldiers survived, resulting in 80% death rate. These heavy casualties forced short pauses for replenishment, giving the Ukrainians valuable time to strengthen defenses and refine tactics.

During this period, Ukrainian forces are focusing on remote mining and fortifying positions concentrating drone presence along expected Russian avenues of advance.


8,475 posted on 11/19/2024 6:30:14 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8468 | View Replies]

To: PIF
"Strikes on Bryansk with ATACMS are a signal that the West seeks escalation," says Russian Foreign Minister Sergey Lavrov.

He also added that European values are 'racist' to Russians, and the Ukrainian government does not represent the majority of people in occupied territory.

https://x.com/NOELreports/status/1858882832459805126

'racist'???

What's next, nazi?

8,476 posted on 11/19/2024 7:08:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8474 | View Replies]

To: AdmSmith
3 Danish navy ships are converging on the Chinese vessel suspect of cutting communication cables right now!

https://x.com/WarMonitor3/status/1858880510275002504


8,477 posted on 11/19/2024 7:11:21 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8459 | View Replies]

To: PIF
Poland's FM Radosław Sikorski says the EU's largest countries are prepared to step up financial and military aid to Ukraine if the US reduces support under a potential Trump administration.

Europe must take more responsibility for its security, he adds.

https://x.com/NOELreports/status/1858889043049636113

The EU gets a vote.

8,478 posted on 11/19/2024 7:16:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8477 | View Replies]

To: BeauBo
🇺🇦 This year we have already produced more than 2.5 million mortar rounds and artillery shells of calibers from 60 to 155 mm. We are increasing this production, — Zelensky.

❗️We have attracted more than 40 foreign defense companies to work in Ukraine. More than 600 domestic companies operate in the defense industry, which in total provide 300,000 jobs.

https://x.com/Maks_NAFO_FELLA/status/1858865328006037658


8,479 posted on 11/19/2024 7:36:29 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8478 | View Replies]

To: FtrPilot
Chinese-flagged cargo ship Yi Peng 3 crossed both submarine cables C-Lion 1 and BSC at times matching when they broke. She was shadowed by Danish navy for a while during night and is now in Danish Straits leaving Baltics.

No signs of boarding. AIS-caveats apply.

https://bsky.app/profile/auonsson.bsky.social/post/3lbc5va7f722p


ALERT
Yi Peng 3
https://www.vesselfinder.com/?imo=9224984

Tailed by DNK Navy Patrol P525
https://www.vesselfinder.com/?mmsi=220436000

and Danpilot Charlie is approaching
https://www.vesselfinder.com/?imo=9839492

8,480 posted on 11/19/2024 7:36:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8477 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,441-8,4608,461-8,4808,481-8,500 ... 18,661-18,677 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson