Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,401-8,4208,421-8,4408,441-8,460 ... 20,241-20,258 next last
To: BeauBo

It is fascinating how Putin acts like Russia is the victim. They get munitions from Iran and Nk at a minimum, but complain about countries assisting Ukraine. More than just NATO is, but what you hear from Russia is NATO NATO NATO.

Russia can attack civilian targets, energy, destroy cities, kill civilians and threaten the world if it does not do what it wants, but when Russia gets a taste of its own medicine they cry foul.

Russia has been using other countries long range weapons for much of the war and certainly theirs since the beginning.

It is about time that Russia suffers the same as Ukraine has since the beginning.

The Russian people need to see what has been wrought on them by their own dear leader


8,421 posted on 11/18/2024 3:09:04 AM PST by blitz128
[ Post Reply | Private Reply | To 8404 | View Replies]

The same people that told you they were winning in Vietnam, that Saddam was about to attack you, that Afghanistan was a "Win" and that Biden was "Sharp as a tack"

Have told you Russia is the aggressor.
And that Ukraine is a Democracy?
They are liars.

pic.twitter.com/SzoVVoKvgt— Chay Bowes (@BowesChay) November 16, 2024


8,422 posted on 11/18/2024 5:53:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8421 | View Replies]

To: blitz128; PIF
Moscow is desperate:

The military begs Putin to declare mobilization. And even chose the “best date”

Valery Gerasimov and several generals close to him addressed the president with a “request and real pleas” to declare mobilization of “ at least 250-300 thousand people.” This was reported by one of the initiators of the appeal. “We need Victory. We are moving forward and suffering huge losses. We need to consolidate our successes and unite society around the SVO [invasion of Ukraine]. There are simply no other options,” our source said.

According to him, Vladimir Vladimirovich has not yet made a decision on mobilization. Therefore, “there is a chance to convince him to meet the military halfway.” Gerasimov and his associates propose starting a new large-scale mobilization in January, soon after the New Year. “This is the best date. Partial demobilization should begin before it. And against this background, men will join the army with greater desire than before. After all, they will have a clear understanding that they can return from the war,” said another source close to the Chief of the General Staff.

Kremlin sources confirmed the fact that the military had appealed to the president regarding mobilization. But they emphasized that Vladimir Vladimirovich had not made any decisions on this matter. “Gerasimov has started some kind of strange game. I would not be surprised if he disrupts demobilization (which he had previously been quite consistent in opposing, - ed.), if he understands that nothing has worked out with mobilization,” noted one of our sources.

https://t.me/kremlin_secrets/4919

They know that a mass mobilization would produce a rebellion against the sick Tzar.

8,423 posted on 11/18/2024 6:46:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8421 | View Replies]

Resolution of the Government of the Russian Federation of November 14, 2024 No. 1546 “On the specifics of payment of monetary compensation for the rental (sublease) of residential premises in the Donetsk People's Republic, Lugansk People's Republic, Zaporizhia Oblast and Kherson Oblast”
November 18, 2024

4. This resolution applies to legal relations that arose from January 1, 2024, and is valid until January 1, 2026.

Source [Do not click unless you have virus protection: https://www.garant.ru/products/ipo/prime/doc/410640760/ ]

Interesting time period.

8,424 posted on 11/18/2024 7:16:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8423 | View Replies]

Elensky: "But strikes are not carried out with words. Such things are not announced. Missiles
will speak for themselves."

He is an actor reading lines, prepared for him by script writers in London and DC.

https://t.co/7zuA7UReBc— Alex Christoforou (@AXChristoforou) November 18, 2024


8,425 posted on 11/18/2024 7:20:11 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8422 | View Replies]

To: PIF
The 54th Mechanized Brigade successfully repelled a Russian assault in the northern direction, destroying several armored vehicles and infantry. Ukrainian defenders used drones, artillery, including cluster shells and copter drops. Two Russian vehicles were left burning.

https://x.com/NOELreports/status/1858528311263084787


8,426 posted on 11/18/2024 7:25:39 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8419 | View Replies]

To: PIF
The 28th Mechanized Brigade destroyed 24 Russian -mainly recon- drones with FPV interceptors.

https://x.com/NOELreports/status/1858526274693611663

Drone wars.

8,427 posted on 11/18/2024 7:27:13 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8426 | View Replies]

To: PIF
Next level Russian tank. Blyatmobile 3.0 modification.

Unfortunately for the Russians, it did not help them and the tank got destroyed.

https://x.com/NOELreports/status/1858493364804460868

So now, ruzzian junk looks like ruzzian junk.


8,428 posted on 11/18/2024 7:29:34 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8427 | View Replies]

To: AdmSmith

declare mobilization of “ at least 250-300 thousand people


And clear out much of Russian remaining work forces.


8,429 posted on 11/18/2024 7:48:41 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8423 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Botched Assault Leaves Hundreds Trapped & Killed ]


Today [ Nov 18 ], there are a lot of interesting updates from the Kursk direction.

Here, two Russian offensive groups remain besieged in 2 separate pockets near Malaya Lokhnya after previous unsuccessful attempts to break them out by the counterattacks of the main Russian forces.

To make the situation more disastrous for the Russians, it has just been exposed that the field commanders in this area lied about the success of the assaults on Malaya Lokhnya and the frontline changes, which led to catastrophic results for the next stage of their planned operation.

Previously, Russian low-level field commanders operating near Pogrebki fabricated reports that contradicted the actual situation on the ground in the Kursk direction.

According to these reports, a mechanized counterattack by the 810th Marine Brigade had successfully retaken control of the villages of Pogrebki, Orlovka, Staraya Sorochina, and Novaya Sorochina. The commanders claimed that the capture of these settlements brought Russian forces directly to the outskirts of Malaya Lokhnya.

This false narrative led to a complete lack of situational awareness on the battlefield. In reality, the Russians did not control these settlements. Instead, 100 Russian soldiers from the broken units were actually encircled with no chance to break out. In an attempt to secretly salvage the situation and align with the reports submitted to higher command, Russian commanders ordered repeated waves of assaults.

Such desperate attempts to fix the situation were not communicated to the Ministry of Defense, and therefore failed to secure the necessary support, which led to even higher unreported losses, significantly depleting the reserves created for the counteroffensive operation.

This approach is common among low-level Russian commanders, who often report the success of their operations prematurely, sometimes days before the reported territorial gains are actually achieved. In this particular section of the front, however, there was no real advancement by Russian forces.

The key issue in this area was that the initial assault forces, which were claimed to have secured the reported territorial gains were running out of supplies and were at the highest risk of being destroyed.

Due to the unawareness of unreported losses, Russian higher-ups in the Ministry of Defense expected the low-level commanders to launch assaults directly against Malaya Lokhnya, assuming that the previously reported positions had been captured.

However, this was not feasible, partly as there were no reserves available for the assault, and no forces stationed at the supposedly secured territories. This discrepancy raised questions both among Russian leadership and the public as to why the planned counterattacks had not progressed according to plan.

It quickly became apparent that the Russian brigade commanders had exhausted their reserves while attempting to capture the territories they had falsely reported as already secured.

This failure also revealed the existence of 2 pockets of Russian troops left encircled as a result of the botched assaults. The shortages of supplies, ammunition, and support eventually led to the complete destruction of 1 of these encircled groups, further exacerbating the already deteriorating situation.

Overall, the poor planning and execution of the 3rd wave of the Russian counteroffensive operation had led to disastrous results, and 100s of soldiers with no way out. The Russian commanders still reported that these units were not encircled but that they actually held the ground, creating significant gaps in battlefield awareness between low and high-level commanders.

As a result, the subsequent waves of assaults were repelled, and the failure to capture the ground has already led to the destruction of half of the encircled troops in 1 of 2 pockets near Malaya Lokhnya.

Despite the heavy losses, recent reports suggest that the Russian command is accumulating both elite marines and paratroopers from the 83rd Airborne Brigade, 155th Marine Brigade, and 51st Airborne Regiment.

They are hoping to expand the scope of their assaults in all areas of Kursk, while the forces in the Malaya Lokhnya-Pogrebki axis are operating from ground zero, after disastrous results of failed attacks.


8,430 posted on 11/18/2024 7:58:32 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8428 | View Replies]

To: PIF
🚀🔥☠️ Russian voenkors write that HIMARS hit the location of Russian troops 20 km from the front line in the occupied part of the Zaporizhzhia region.

Waiting for a photo or video! 👀

https://x.com/Maks_NAFO_FELLA/status/1858533376006775052


8,431 posted on 11/18/2024 8:36:37 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8428 | View Replies]

To: PIF
🔥The 🇺🇦 Incognito Group, 54th Mechanised Brigade terrifies Russian "tourists" in Donetsk region.

Only horrors await Russians here🔥

https://x.com/GloOouD/status/1858540600137535648

The quality of the IIR video is amazing.

8,432 posted on 11/18/2024 8:44:38 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8431 | View Replies]

To: PIF; BeauBo
Heroic Ukrainian resistance fighters have derailed 2 trains & damaged a main rail line from occupied Donetsk city to Mariupol. This around 20km north of Mariupol near village of Kal'chyk.

Russia's trying to upgrade the line here, to aid its occupation of Mariupol city.

https://x.com/GlasnostGone/status/1858506530926055818


8,433 posted on 11/18/2024 9:47:47 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8432 | View Replies]

To: PIF
We are now scaling up Ukrainian missile production. The first 100 missiles have already been produced this year. Serial production of R-360 Neptune cruise missiles has been successfully expanded, with upgrades enabling strikes at longer distances.

https://x.com/DefenceU/status/1858555251772846351


8,434 posted on 11/18/2024 10:10:59 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8433 | View Replies]

To: FtrPilot

Reminder to everyone that the SpaceX Flight 6 will go off at 4pm CST.


8,435 posted on 11/18/2024 10:24:05 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8434 | View Replies]

To: FtrPilot

Kremlin snuff box, 11/18/24
https://t.me/s/kremlin_secrets

Shelling of Moscow and the threat of sabotage. What to expect before the New Year?

Friends, the time has come to post this systematic post, because, alas, we were not heard on a number of points. In particular, some of our interlocutors were sincerely surprised by the drone attacks in Izhevsk and Moscow. Like how is this? The crests are bombing Moscow again?

It’s not just that we warned: air defense systems are not in short supply, but they are not enough to close all the facilities. But we stubbornly, instead of the front and protecting important objects in the rear, guarded Moscow and transferred air defense to Iran [ https://t.me/kremlin_secrets/4723 ] (there, if you remember, they were also dissatisfied with the result of the work of our systems [ https://t.me/kremlin_secrets/4823 ]).

Air defense is not cartridges for a machine gun, it is complex equipment that can either be purchased or produced. Since production and repairs have reached the ceiling of possibilities, the only option left is to buy. Purchase!!! Not by selling or exchanging, even with a close partner.

As for sabotage, sources confirmed data on the preparation of at least several attacks, not only in Moscow. Who exactly and when is not specified, but the dangerous period is New Year Eve.

We are, of course, worried about the life and health of our President, but now a good and correct step would be to remove the air defense systems from a number of residences.

Of course, not all. And the military covers not only the Presidential residences, but also a number of other officials and influential people. We are convinced that protecting the military at the front and the civilian residents of the capital is now much more important.

The FSB and the police are working to prevent sabotage, but the threat is very real. Even teenagers and members of the North Military District who returned from the war are involved in active actions. Be careful!


8,436 posted on 11/18/2024 10:28:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8434 | View Replies]

To: BeauBo

Trump Pledges Peace And To End The War Between Russia and Ukraine and Urges Both Leaders Contact Him To Meet Immediately.

Watch Our Live Stream Here:https://t.co/dGxbHHkT5O pic.twitter.com/YBgtSeviHd— Alex Jones (@RealAlexJones) November 18, 2024


8,437 posted on 11/18/2024 11:52:08 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8404 | View Replies]

To: PIF
In the Kursk region, Ukrainian operators from 8th SSO regiment's UA REG TEAM destroyed a massive amount of Russian equipment.

https://x.com/NOELreports/status/1858593865688559758

5:38 Video.

8,438 posted on 11/18/2024 12:41:27 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8434 | View Replies]

To: BeauBo
War in Ukraine 🇺🇦 🇷🇺 Ukrainian FPV drone operators destroy two Russian tanks in the same ruined settlement.

Both machines are beheaded as they lose their turrets

https://x.com/AncientAlien01/status/1858457041242591465


8,439 posted on 11/18/2024 12:43:03 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8438 | View Replies]

To: PIF
Kursk region

Enemy elimination

https://x.com/Heroiam_Slava/status/1858558819623686145


8,440 posted on 11/18/2024 12:45:16 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8439 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,401-8,4208,421-8,4408,441-8,460 ... 20,241-20,258 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson